ID: 915629233

View in Genome Browser
Species Human (GRCh38)
Location 1:157138657-157138679
Sequence CCCTGGCCCAGCAGCGGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915629233_915629239 -5 Left 915629233 1:157138657-157138679 CCCGGTCCGCTGCTGGGCCAGGG No data
Right 915629239 1:157138675-157138697 CAGGGTCCTCCAGACGCCGAGGG No data
915629233_915629240 -4 Left 915629233 1:157138657-157138679 CCCGGTCCGCTGCTGGGCCAGGG No data
Right 915629240 1:157138676-157138698 AGGGTCCTCCAGACGCCGAGGGG No data
915629233_915629238 -6 Left 915629233 1:157138657-157138679 CCCGGTCCGCTGCTGGGCCAGGG No data
Right 915629238 1:157138674-157138696 CCAGGGTCCTCCAGACGCCGAGG No data
915629233_915629248 14 Left 915629233 1:157138657-157138679 CCCGGTCCGCTGCTGGGCCAGGG No data
Right 915629248 1:157138694-157138716 AGGGGTGACGCGGCGCGAGGGGG No data
915629233_915629246 12 Left 915629233 1:157138657-157138679 CCCGGTCCGCTGCTGGGCCAGGG No data
Right 915629246 1:157138692-157138714 CGAGGGGTGACGCGGCGCGAGGG No data
915629233_915629243 4 Left 915629233 1:157138657-157138679 CCCGGTCCGCTGCTGGGCCAGGG No data
Right 915629243 1:157138684-157138706 CCAGACGCCGAGGGGTGACGCGG No data
915629233_915629247 13 Left 915629233 1:157138657-157138679 CCCGGTCCGCTGCTGGGCCAGGG No data
Right 915629247 1:157138693-157138715 GAGGGGTGACGCGGCGCGAGGGG No data
915629233_915629245 11 Left 915629233 1:157138657-157138679 CCCGGTCCGCTGCTGGGCCAGGG No data
Right 915629245 1:157138691-157138713 CCGAGGGGTGACGCGGCGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915629233 Original CRISPR CCCTGGCCCAGCAGCGGACC GGG (reversed) Intergenic