ID: 915629236

View in Genome Browser
Species Human (GRCh38)
Location 1:157138663-157138685
Sequence GGAGGACCCTGGCCCAGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915629236_915629243 -2 Left 915629236 1:157138663-157138685 CCGCTGCTGGGCCAGGGTCCTCC No data
Right 915629243 1:157138684-157138706 CCAGACGCCGAGGGGTGACGCGG No data
915629236_915629248 8 Left 915629236 1:157138663-157138685 CCGCTGCTGGGCCAGGGTCCTCC No data
Right 915629248 1:157138694-157138716 AGGGGTGACGCGGCGCGAGGGGG No data
915629236_915629240 -10 Left 915629236 1:157138663-157138685 CCGCTGCTGGGCCAGGGTCCTCC No data
Right 915629240 1:157138676-157138698 AGGGTCCTCCAGACGCCGAGGGG No data
915629236_915629246 6 Left 915629236 1:157138663-157138685 CCGCTGCTGGGCCAGGGTCCTCC No data
Right 915629246 1:157138692-157138714 CGAGGGGTGACGCGGCGCGAGGG No data
915629236_915629245 5 Left 915629236 1:157138663-157138685 CCGCTGCTGGGCCAGGGTCCTCC No data
Right 915629245 1:157138691-157138713 CCGAGGGGTGACGCGGCGCGAGG No data
915629236_915629247 7 Left 915629236 1:157138663-157138685 CCGCTGCTGGGCCAGGGTCCTCC No data
Right 915629247 1:157138693-157138715 GAGGGGTGACGCGGCGCGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915629236 Original CRISPR GGAGGACCCTGGCCCAGCAG CGG (reversed) Intergenic