ID: 915629237

View in Genome Browser
Species Human (GRCh38)
Location 1:157138674-157138696
Sequence CCTCGGCGTCTGGAGGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915629237_915629247 -4 Left 915629237 1:157138674-157138696 CCAGGGTCCTCCAGACGCCGAGG No data
Right 915629247 1:157138693-157138715 GAGGGGTGACGCGGCGCGAGGGG No data
915629237_915629248 -3 Left 915629237 1:157138674-157138696 CCAGGGTCCTCCAGACGCCGAGG No data
Right 915629248 1:157138694-157138716 AGGGGTGACGCGGCGCGAGGGGG No data
915629237_915629245 -6 Left 915629237 1:157138674-157138696 CCAGGGTCCTCCAGACGCCGAGG No data
Right 915629245 1:157138691-157138713 CCGAGGGGTGACGCGGCGCGAGG No data
915629237_915629246 -5 Left 915629237 1:157138674-157138696 CCAGGGTCCTCCAGACGCCGAGG No data
Right 915629246 1:157138692-157138714 CGAGGGGTGACGCGGCGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915629237 Original CRISPR CCTCGGCGTCTGGAGGACCC TGG (reversed) Intergenic