ID: 915629238

View in Genome Browser
Species Human (GRCh38)
Location 1:157138674-157138696
Sequence CCAGGGTCCTCCAGACGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915629231_915629238 -2 Left 915629231 1:157138653-157138675 CCGGCCCGGTCCGCTGCTGGGCC No data
Right 915629238 1:157138674-157138696 CCAGGGTCCTCCAGACGCCGAGG No data
915629235_915629238 -7 Left 915629235 1:157138658-157138680 CCGGTCCGCTGCTGGGCCAGGGT No data
Right 915629238 1:157138674-157138696 CCAGGGTCCTCCAGACGCCGAGG No data
915629233_915629238 -6 Left 915629233 1:157138657-157138679 CCCGGTCCGCTGCTGGGCCAGGG No data
Right 915629238 1:157138674-157138696 CCAGGGTCCTCCAGACGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915629238 Original CRISPR CCAGGGTCCTCCAGACGCCG AGG Intergenic