ID: 915629239

View in Genome Browser
Species Human (GRCh38)
Location 1:157138675-157138697
Sequence CAGGGTCCTCCAGACGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915629231_915629239 -1 Left 915629231 1:157138653-157138675 CCGGCCCGGTCCGCTGCTGGGCC No data
Right 915629239 1:157138675-157138697 CAGGGTCCTCCAGACGCCGAGGG No data
915629235_915629239 -6 Left 915629235 1:157138658-157138680 CCGGTCCGCTGCTGGGCCAGGGT No data
Right 915629239 1:157138675-157138697 CAGGGTCCTCCAGACGCCGAGGG No data
915629233_915629239 -5 Left 915629233 1:157138657-157138679 CCCGGTCCGCTGCTGGGCCAGGG No data
Right 915629239 1:157138675-157138697 CAGGGTCCTCCAGACGCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915629239 Original CRISPR CAGGGTCCTCCAGACGCCGA GGG Intergenic