ID: 915629243

View in Genome Browser
Species Human (GRCh38)
Location 1:157138684-157138706
Sequence CCAGACGCCGAGGGGTGACG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915629236_915629243 -2 Left 915629236 1:157138663-157138685 CCGCTGCTGGGCCAGGGTCCTCC No data
Right 915629243 1:157138684-157138706 CCAGACGCCGAGGGGTGACGCGG No data
915629231_915629243 8 Left 915629231 1:157138653-157138675 CCGGCCCGGTCCGCTGCTGGGCC No data
Right 915629243 1:157138684-157138706 CCAGACGCCGAGGGGTGACGCGG No data
915629233_915629243 4 Left 915629233 1:157138657-157138679 CCCGGTCCGCTGCTGGGCCAGGG No data
Right 915629243 1:157138684-157138706 CCAGACGCCGAGGGGTGACGCGG No data
915629235_915629243 3 Left 915629235 1:157138658-157138680 CCGGTCCGCTGCTGGGCCAGGGT No data
Right 915629243 1:157138684-157138706 CCAGACGCCGAGGGGTGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915629243 Original CRISPR CCAGACGCCGAGGGGTGACG CGG Intergenic