ID: 915629245

View in Genome Browser
Species Human (GRCh38)
Location 1:157138691-157138713
Sequence CCGAGGGGTGACGCGGCGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915629233_915629245 11 Left 915629233 1:157138657-157138679 CCCGGTCCGCTGCTGGGCCAGGG No data
Right 915629245 1:157138691-157138713 CCGAGGGGTGACGCGGCGCGAGG No data
915629237_915629245 -6 Left 915629237 1:157138674-157138696 CCAGGGTCCTCCAGACGCCGAGG No data
Right 915629245 1:157138691-157138713 CCGAGGGGTGACGCGGCGCGAGG No data
915629231_915629245 15 Left 915629231 1:157138653-157138675 CCGGCCCGGTCCGCTGCTGGGCC No data
Right 915629245 1:157138691-157138713 CCGAGGGGTGACGCGGCGCGAGG No data
915629236_915629245 5 Left 915629236 1:157138663-157138685 CCGCTGCTGGGCCAGGGTCCTCC No data
Right 915629245 1:157138691-157138713 CCGAGGGGTGACGCGGCGCGAGG No data
915629235_915629245 10 Left 915629235 1:157138658-157138680 CCGGTCCGCTGCTGGGCCAGGGT No data
Right 915629245 1:157138691-157138713 CCGAGGGGTGACGCGGCGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915629245 Original CRISPR CCGAGGGGTGACGCGGCGCG AGG Intergenic