ID: 915629248

View in Genome Browser
Species Human (GRCh38)
Location 1:157138694-157138716
Sequence AGGGGTGACGCGGCGCGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915629233_915629248 14 Left 915629233 1:157138657-157138679 CCCGGTCCGCTGCTGGGCCAGGG No data
Right 915629248 1:157138694-157138716 AGGGGTGACGCGGCGCGAGGGGG No data
915629236_915629248 8 Left 915629236 1:157138663-157138685 CCGCTGCTGGGCCAGGGTCCTCC No data
Right 915629248 1:157138694-157138716 AGGGGTGACGCGGCGCGAGGGGG No data
915629241_915629248 -10 Left 915629241 1:157138681-157138703 CCTCCAGACGCCGAGGGGTGACG No data
Right 915629248 1:157138694-157138716 AGGGGTGACGCGGCGCGAGGGGG No data
915629237_915629248 -3 Left 915629237 1:157138674-157138696 CCAGGGTCCTCCAGACGCCGAGG No data
Right 915629248 1:157138694-157138716 AGGGGTGACGCGGCGCGAGGGGG No data
915629231_915629248 18 Left 915629231 1:157138653-157138675 CCGGCCCGGTCCGCTGCTGGGCC No data
Right 915629248 1:157138694-157138716 AGGGGTGACGCGGCGCGAGGGGG No data
915629235_915629248 13 Left 915629235 1:157138658-157138680 CCGGTCCGCTGCTGGGCCAGGGT No data
Right 915629248 1:157138694-157138716 AGGGGTGACGCGGCGCGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915629248 Original CRISPR AGGGGTGACGCGGCGCGAGG GGG Intergenic