ID: 915631973

View in Genome Browser
Species Human (GRCh38)
Location 1:157159726-157159748
Sequence CTGAAAATTCATATGGACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915631967_915631973 9 Left 915631967 1:157159694-157159716 CCCCTGTTGTGTCTCAGGTTCAG No data
Right 915631973 1:157159726-157159748 CTGAAAATTCATATGGACTAAGG No data
915631968_915631973 8 Left 915631968 1:157159695-157159717 CCCTGTTGTGTCTCAGGTTCAGG No data
Right 915631973 1:157159726-157159748 CTGAAAATTCATATGGACTAAGG No data
915631970_915631973 7 Left 915631970 1:157159696-157159718 CCTGTTGTGTCTCAGGTTCAGGA No data
Right 915631973 1:157159726-157159748 CTGAAAATTCATATGGACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915631973 Original CRISPR CTGAAAATTCATATGGACTA AGG Intergenic
No off target data available for this crispr