ID: 915633527

View in Genome Browser
Species Human (GRCh38)
Location 1:157170867-157170889
Sequence TTATTTCAGAATAAAATTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915633527_915633533 14 Left 915633527 1:157170867-157170889 CCAATAATTTTATTCTGAAATAA No data
Right 915633533 1:157170904-157170926 AGAGCCACGAGGGGGCGCCCTGG No data
915633527_915633537 29 Left 915633527 1:157170867-157170889 CCAATAATTTTATTCTGAAATAA No data
Right 915633537 1:157170919-157170941 CGCCCTGGACTCTGGCCTGGTGG No data
915633527_915633530 4 Left 915633527 1:157170867-157170889 CCAATAATTTTATTCTGAAATAA No data
Right 915633530 1:157170894-157170916 TGGTAAACGCAGAGCCACGAGGG No data
915633527_915633529 3 Left 915633527 1:157170867-157170889 CCAATAATTTTATTCTGAAATAA No data
Right 915633529 1:157170893-157170915 TTGGTAAACGCAGAGCCACGAGG No data
915633527_915633535 21 Left 915633527 1:157170867-157170889 CCAATAATTTTATTCTGAAATAA No data
Right 915633535 1:157170911-157170933 CGAGGGGGCGCCCTGGACTCTGG No data
915633527_915633536 26 Left 915633527 1:157170867-157170889 CCAATAATTTTATTCTGAAATAA No data
Right 915633536 1:157170916-157170938 GGGCGCCCTGGACTCTGGCCTGG No data
915633527_915633531 5 Left 915633527 1:157170867-157170889 CCAATAATTTTATTCTGAAATAA No data
Right 915633531 1:157170895-157170917 GGTAAACGCAGAGCCACGAGGGG No data
915633527_915633532 6 Left 915633527 1:157170867-157170889 CCAATAATTTTATTCTGAAATAA No data
Right 915633532 1:157170896-157170918 GTAAACGCAGAGCCACGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915633527 Original CRISPR TTATTTCAGAATAAAATTAT TGG (reversed) Intergenic
No off target data available for this crispr