ID: 915633537

View in Genome Browser
Species Human (GRCh38)
Location 1:157170919-157170941
Sequence CGCCCTGGACTCTGGCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915633527_915633537 29 Left 915633527 1:157170867-157170889 CCAATAATTTTATTCTGAAATAA No data
Right 915633537 1:157170919-157170941 CGCCCTGGACTCTGGCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915633537 Original CRISPR CGCCCTGGACTCTGGCCTGG TGG Intergenic
No off target data available for this crispr