ID: 915634113

View in Genome Browser
Species Human (GRCh38)
Location 1:157174418-157174440
Sequence AAGCCTCGGTGGTCTCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915634113_915634122 9 Left 915634113 1:157174418-157174440 CCCCAGTGAGACCACCGAGGCTT No data
Right 915634122 1:157174450-157174472 GCATGTGTGCAGGGCTGTGCTGG No data
915634113_915634124 17 Left 915634113 1:157174418-157174440 CCCCAGTGAGACCACCGAGGCTT No data
Right 915634124 1:157174458-157174480 GCAGGGCTGTGCTGGGCGTGAGG No data
915634113_915634125 26 Left 915634113 1:157174418-157174440 CCCCAGTGAGACCACCGAGGCTT No data
Right 915634125 1:157174467-157174489 TGCTGGGCGTGAGGCAGTGCAGG No data
915634113_915634123 10 Left 915634113 1:157174418-157174440 CCCCAGTGAGACCACCGAGGCTT No data
Right 915634123 1:157174451-157174473 CATGTGTGCAGGGCTGTGCTGGG No data
915634113_915634120 0 Left 915634113 1:157174418-157174440 CCCCAGTGAGACCACCGAGGCTT No data
Right 915634120 1:157174441-157174463 TTCAGGCCAGCATGTGTGCAGGG No data
915634113_915634119 -1 Left 915634113 1:157174418-157174440 CCCCAGTGAGACCACCGAGGCTT No data
Right 915634119 1:157174440-157174462 TTTCAGGCCAGCATGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915634113 Original CRISPR AAGCCTCGGTGGTCTCACTG GGG (reversed) Intergenic
No off target data available for this crispr