ID: 915638452

View in Genome Browser
Species Human (GRCh38)
Location 1:157202980-157203002
Sequence ATTTTTAAGGAGCTTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915638449_915638452 25 Left 915638449 1:157202932-157202954 CCTTCATGTTGTTATTTAAAAAC No data
Right 915638452 1:157202980-157203002 ATTTTTAAGGAGCTTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915638452 Original CRISPR ATTTTTAAGGAGCTTGAGGA AGG Intergenic
No off target data available for this crispr