ID: 915639160

View in Genome Browser
Species Human (GRCh38)
Location 1:157208665-157208687
Sequence GATGCTGCTGCCCCAAGATT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915639156_915639160 3 Left 915639156 1:157208639-157208661 CCCTCATAGCAAATCCTTCGCCA No data
Right 915639160 1:157208665-157208687 GATGCTGCTGCCCCAAGATTCGG No data
915639157_915639160 2 Left 915639157 1:157208640-157208662 CCTCATAGCAAATCCTTCGCCAA No data
Right 915639160 1:157208665-157208687 GATGCTGCTGCCCCAAGATTCGG No data
915639155_915639160 17 Left 915639155 1:157208625-157208647 CCTTCTTGTCTTTACCCTCATAG No data
Right 915639160 1:157208665-157208687 GATGCTGCTGCCCCAAGATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915639160 Original CRISPR GATGCTGCTGCCCCAAGATT CGG Intergenic
No off target data available for this crispr