ID: 915645711

View in Genome Browser
Species Human (GRCh38)
Location 1:157270475-157270497
Sequence TGTGCCCTAGGAAACTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915645707_915645711 13 Left 915645707 1:157270439-157270461 CCATCTGGGAAGACACAGAGATA No data
Right 915645711 1:157270475-157270497 TGTGCCCTAGGAAACTATGGAGG No data
915645706_915645711 25 Left 915645706 1:157270427-157270449 CCTGGGACTATGCCATCTGGGAA No data
Right 915645711 1:157270475-157270497 TGTGCCCTAGGAAACTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915645711 Original CRISPR TGTGCCCTAGGAAACTATGG AGG Intergenic
No off target data available for this crispr