ID: 915647201

View in Genome Browser
Species Human (GRCh38)
Location 1:157281402-157281424
Sequence TAGAGCAGGGAGAAGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915647190_915647201 16 Left 915647190 1:157281363-157281385 CCTGCCTCACTTCCCTGTGATAA No data
Right 915647201 1:157281402-157281424 TAGAGCAGGGAGAAGGGAGCAGG No data
915647193_915647201 4 Left 915647193 1:157281375-157281397 CCCTGTGATAAGTGGTGTTGAGG No data
Right 915647201 1:157281402-157281424 TAGAGCAGGGAGAAGGGAGCAGG No data
915647195_915647201 3 Left 915647195 1:157281376-157281398 CCTGTGATAAGTGGTGTTGAGGA No data
Right 915647201 1:157281402-157281424 TAGAGCAGGGAGAAGGGAGCAGG No data
915647191_915647201 12 Left 915647191 1:157281367-157281389 CCTCACTTCCCTGTGATAAGTGG No data
Right 915647201 1:157281402-157281424 TAGAGCAGGGAGAAGGGAGCAGG No data
915647189_915647201 17 Left 915647189 1:157281362-157281384 CCCTGCCTCACTTCCCTGTGATA No data
Right 915647201 1:157281402-157281424 TAGAGCAGGGAGAAGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915647201 Original CRISPR TAGAGCAGGGAGAAGGGAGC AGG Intergenic
No off target data available for this crispr