ID: 915648953

View in Genome Browser
Species Human (GRCh38)
Location 1:157293696-157293718
Sequence GCCTGTGGTCCTGGTGCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915648953_915648959 6 Left 915648953 1:157293696-157293718 CCCTTAGCACCAGGACCACAGGC No data
Right 915648959 1:157293725-157293747 GATCCACATCAGTGAGTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915648953 Original CRISPR GCCTGTGGTCCTGGTGCTAA GGG (reversed) Intergenic
No off target data available for this crispr