ID: 915650424

View in Genome Browser
Species Human (GRCh38)
Location 1:157306609-157306631
Sequence CCAGCAGCCGCCCCTCTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915650414_915650424 7 Left 915650414 1:157306579-157306601 CCCAGCTTCCAGGCTGCTATCCT No data
Right 915650424 1:157306609-157306631 CCAGCAGCCGCCCCTCTCAGGGG No data
915650416_915650424 -1 Left 915650416 1:157306587-157306609 CCAGGCTGCTATCCTTTCCTCCC No data
Right 915650424 1:157306609-157306631 CCAGCAGCCGCCCCTCTCAGGGG No data
915650413_915650424 16 Left 915650413 1:157306570-157306592 CCAGGTGTTCCCAGCTTCCAGGC No data
Right 915650424 1:157306609-157306631 CCAGCAGCCGCCCCTCTCAGGGG No data
915650411_915650424 29 Left 915650411 1:157306557-157306579 CCTGGAATCAGAACCAGGTGTTC No data
Right 915650424 1:157306609-157306631 CCAGCAGCCGCCCCTCTCAGGGG No data
915650415_915650424 6 Left 915650415 1:157306580-157306602 CCAGCTTCCAGGCTGCTATCCTT No data
Right 915650424 1:157306609-157306631 CCAGCAGCCGCCCCTCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915650424 Original CRISPR CCAGCAGCCGCCCCTCTCAG GGG Intergenic
No off target data available for this crispr