ID: 915650532

View in Genome Browser
Species Human (GRCh38)
Location 1:157307328-157307350
Sequence GAAAACTCTGGGTGTCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915650532_915650536 0 Left 915650532 1:157307328-157307350 CCACAGGGACACCCAGAGTTTTC No data
Right 915650536 1:157307351-157307373 TCTCTGAAGGAGCCCAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915650532 Original CRISPR GAAAACTCTGGGTGTCCCTG TGG (reversed) Intergenic
No off target data available for this crispr