ID: 915651127

View in Genome Browser
Species Human (GRCh38)
Location 1:157311662-157311684
Sequence GCCCAGGCAGAACACCCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915651116_915651127 22 Left 915651116 1:157311617-157311639 CCCAGGCACCGCCTCCTTCTCCT No data
Right 915651127 1:157311662-157311684 GCCCAGGCAGAACACCCCCAAGG No data
915651119_915651127 11 Left 915651119 1:157311628-157311650 CCTCCTTCTCCTCAAGTAGTCTC No data
Right 915651127 1:157311662-157311684 GCCCAGGCAGAACACCCCCAAGG No data
915651120_915651127 8 Left 915651120 1:157311631-157311653 CCTTCTCCTCAAGTAGTCTCCCC No data
Right 915651127 1:157311662-157311684 GCCCAGGCAGAACACCCCCAAGG No data
915651117_915651127 21 Left 915651117 1:157311618-157311640 CCAGGCACCGCCTCCTTCTCCTC No data
Right 915651127 1:157311662-157311684 GCCCAGGCAGAACACCCCCAAGG No data
915651121_915651127 2 Left 915651121 1:157311637-157311659 CCTCAAGTAGTCTCCCCTGATGG No data
Right 915651127 1:157311662-157311684 GCCCAGGCAGAACACCCCCAAGG No data
915651115_915651127 23 Left 915651115 1:157311616-157311638 CCCCAGGCACCGCCTCCTTCTCC No data
Right 915651127 1:157311662-157311684 GCCCAGGCAGAACACCCCCAAGG No data
915651118_915651127 14 Left 915651118 1:157311625-157311647 CCGCCTCCTTCTCCTCAAGTAGT No data
Right 915651127 1:157311662-157311684 GCCCAGGCAGAACACCCCCAAGG No data
915651114_915651127 24 Left 915651114 1:157311615-157311637 CCCCCAGGCACCGCCTCCTTCTC No data
Right 915651127 1:157311662-157311684 GCCCAGGCAGAACACCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915651127 Original CRISPR GCCCAGGCAGAACACCCCCA AGG Intergenic
No off target data available for this crispr