ID: 915656910

View in Genome Browser
Species Human (GRCh38)
Location 1:157368309-157368331
Sequence AGGCACCTGATTCTAAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915656910_915656915 2 Left 915656910 1:157368309-157368331 CCTTTCCTTAGAATCAGGTGCCT No data
Right 915656915 1:157368334-157368356 CTTCGTGGTCTCCATGCCATAGG No data
915656910_915656920 25 Left 915656910 1:157368309-157368331 CCTTTCCTTAGAATCAGGTGCCT No data
Right 915656920 1:157368357-157368379 CCCTGGACCTGAGCTGTTTGTGG No data
915656910_915656922 29 Left 915656910 1:157368309-157368331 CCTTTCCTTAGAATCAGGTGCCT No data
Right 915656922 1:157368361-157368383 GGACCTGAGCTGTTTGTGGCAGG No data
915656910_915656916 8 Left 915656910 1:157368309-157368331 CCTTTCCTTAGAATCAGGTGCCT No data
Right 915656916 1:157368340-157368362 GGTCTCCATGCCATAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915656910 Original CRISPR AGGCACCTGATTCTAAGGAA AGG (reversed) Intergenic
No off target data available for this crispr