ID: 915657902

View in Genome Browser
Species Human (GRCh38)
Location 1:157376751-157376773
Sequence GAAGATACTCCCCTATTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915657895_915657902 24 Left 915657895 1:157376704-157376726 CCCTGACCATCTCGGAGTCTGTG No data
Right 915657902 1:157376751-157376773 GAAGATACTCCCCTATTAATAGG No data
915657896_915657902 23 Left 915657896 1:157376705-157376727 CCTGACCATCTCGGAGTCTGTGT No data
Right 915657902 1:157376751-157376773 GAAGATACTCCCCTATTAATAGG No data
915657894_915657902 29 Left 915657894 1:157376699-157376721 CCTCACCCTGACCATCTCGGAGT No data
Right 915657902 1:157376751-157376773 GAAGATACTCCCCTATTAATAGG No data
915657893_915657902 30 Left 915657893 1:157376698-157376720 CCCTCACCCTGACCATCTCGGAG No data
Right 915657902 1:157376751-157376773 GAAGATACTCCCCTATTAATAGG No data
915657897_915657902 18 Left 915657897 1:157376710-157376732 CCATCTCGGAGTCTGTGTCCAGT No data
Right 915657902 1:157376751-157376773 GAAGATACTCCCCTATTAATAGG No data
915657900_915657902 -10 Left 915657900 1:157376738-157376760 CCCTTGTTATCTGGAAGATACTC No data
Right 915657902 1:157376751-157376773 GAAGATACTCCCCTATTAATAGG No data
915657898_915657902 0 Left 915657898 1:157376728-157376750 CCAGTAATATCCCTTGTTATCTG No data
Right 915657902 1:157376751-157376773 GAAGATACTCCCCTATTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915657902 Original CRISPR GAAGATACTCCCCTATTAAT AGG Intergenic
No off target data available for this crispr