ID: 915660860

View in Genome Browser
Species Human (GRCh38)
Location 1:157403838-157403860
Sequence GAAGACTCTGGGTGTCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915660856_915660860 8 Left 915660856 1:157403807-157403829 CCAGTGAGCCTGTTTCAGGCTTC No data
Right 915660860 1:157403838-157403860 GAAGACTCTGGGTGTCCCTGTGG No data
915660857_915660860 0 Left 915660857 1:157403815-157403837 CCTGTTTCAGGCTTCTTCAGAGA No data
Right 915660860 1:157403838-157403860 GAAGACTCTGGGTGTCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915660860 Original CRISPR GAAGACTCTGGGTGTCCCTG TGG Intergenic
No off target data available for this crispr