ID: 915661402

View in Genome Browser
Species Human (GRCh38)
Location 1:157408675-157408697
Sequence CCTTATAAAAAGAGGGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915661402_915661408 28 Left 915661402 1:157408675-157408697 CCAGATTCCCTCTTTTTATAAGG No data
Right 915661408 1:157408726-157408748 CCTCGTGACCTCATCTTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915661402 Original CRISPR CCTTATAAAAAGAGGGAATC TGG (reversed) Intergenic
No off target data available for this crispr