ID: 915662191

View in Genome Browser
Species Human (GRCh38)
Location 1:157413725-157413747
Sequence GCAGCTTGTGTGACTGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915662191_915662194 13 Left 915662191 1:157413725-157413747 CCAGACTCAGTCACACAAGCTGC No data
Right 915662194 1:157413761-157413783 CTCAAAGACTCCATATGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915662191 Original CRISPR GCAGCTTGTGTGACTGAGTC TGG (reversed) Intergenic
No off target data available for this crispr