ID: 915665116

View in Genome Browser
Species Human (GRCh38)
Location 1:157437469-157437491
Sequence CAGCCAGGGTTGGGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915665116_915665125 19 Left 915665116 1:157437469-157437491 CCTTTTTTCCCCAACCCTGGCTG No data
Right 915665125 1:157437511-157437533 AGACTGGTGCAACATCACCATGG No data
915665116_915665127 23 Left 915665116 1:157437469-157437491 CCTTTTTTCCCCAACCCTGGCTG No data
Right 915665127 1:157437515-157437537 TGGTGCAACATCACCATGGAGGG No data
915665116_915665128 28 Left 915665116 1:157437469-157437491 CCTTTTTTCCCCAACCCTGGCTG No data
Right 915665128 1:157437520-157437542 CAACATCACCATGGAGGGCAAGG No data
915665116_915665122 3 Left 915665116 1:157437469-157437491 CCTTTTTTCCCCAACCCTGGCTG No data
Right 915665122 1:157437495-157437517 CACCAACCATCACAGCAGACTGG No data
915665116_915665126 22 Left 915665116 1:157437469-157437491 CCTTTTTTCCCCAACCCTGGCTG No data
Right 915665126 1:157437514-157437536 CTGGTGCAACATCACCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915665116 Original CRISPR CAGCCAGGGTTGGGGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr