ID: 915667667

View in Genome Browser
Species Human (GRCh38)
Location 1:157459607-157459629
Sequence GACAGCTCTTGGTCTGTTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915667667_915667671 11 Left 915667667 1:157459607-157459629 CCCGCAACAGACCAAGAGCTGTC No data
Right 915667671 1:157459641-157459663 GAGTAGTCATCTGCCAAAGATGG No data
915667667_915667672 16 Left 915667667 1:157459607-157459629 CCCGCAACAGACCAAGAGCTGTC No data
Right 915667672 1:157459646-157459668 GTCATCTGCCAAAGATGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915667667 Original CRISPR GACAGCTCTTGGTCTGTTGC GGG (reversed) Intergenic
No off target data available for this crispr