ID: 915670155

View in Genome Browser
Species Human (GRCh38)
Location 1:157482328-157482350
Sequence CACCTTCTGCATCTTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915670155_915670156 -3 Left 915670155 1:157482328-157482350 CCAAGCTGAAGATGCAGAAGGTG No data
Right 915670156 1:157482348-157482370 GTGACTCAGACCCTGTCTCCTGG No data
915670155_915670158 7 Left 915670155 1:157482328-157482350 CCAAGCTGAAGATGCAGAAGGTG No data
Right 915670158 1:157482358-157482380 CCCTGTCTCCTGGATCTCTCAGG No data
915670155_915670160 8 Left 915670155 1:157482328-157482350 CCAAGCTGAAGATGCAGAAGGTG No data
Right 915670160 1:157482359-157482381 CCTGTCTCCTGGATCTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915670155 Original CRISPR CACCTTCTGCATCTTCAGCT TGG (reversed) Intergenic
No off target data available for this crispr