ID: 915671156

View in Genome Browser
Species Human (GRCh38)
Location 1:157490211-157490233
Sequence CAAGATACTCCCCATTAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915671153_915671156 9 Left 915671153 1:157490179-157490201 CCTGTCTGGGGATGGGTACCAAG No data
Right 915671156 1:157490211-157490233 CAAGATACTCCCCATTAATAAGG No data
915671154_915671156 -9 Left 915671154 1:157490197-157490219 CCAAGTCAGCAAACCAAGATACT No data
Right 915671156 1:157490211-157490233 CAAGATACTCCCCATTAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915671156 Original CRISPR CAAGATACTCCCCATTAATA AGG Intergenic
No off target data available for this crispr