ID: 915671253

View in Genome Browser
Species Human (GRCh38)
Location 1:157490748-157490770
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915671253_915671263 29 Left 915671253 1:157490748-157490770 CCACCAGGCCAGAGTCCAGGGCG No data
Right 915671263 1:157490800-157490822 TTTCTTCAAAGTAAAACTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915671253 Original CRISPR CGCCCTGGACTCTGGCCTGG TGG (reversed) Intergenic
No off target data available for this crispr