ID: 915671982

View in Genome Browser
Species Human (GRCh38)
Location 1:157497286-157497308
Sequence GTTTTTAAGGATATAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915671982_915671994 13 Left 915671982 1:157497286-157497308 CCCTCCACTATATCCTTAAAAAC No data
Right 915671994 1:157497322-157497344 TTCTCAGGGAGATGGATTTGAGG No data
915671982_915671988 -1 Left 915671982 1:157497286-157497308 CCCTCCACTATATCCTTAAAAAC No data
Right 915671988 1:157497308-157497330 CCCCAGCCCAGAACTTCTCAGGG No data
915671982_915671992 5 Left 915671982 1:157497286-157497308 CCCTCCACTATATCCTTAAAAAC No data
Right 915671992 1:157497314-157497336 CCCAGAACTTCTCAGGGAGATGG No data
915671982_915671986 -2 Left 915671982 1:157497286-157497308 CCCTCCACTATATCCTTAAAAAC No data
Right 915671986 1:157497307-157497329 ACCCCAGCCCAGAACTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915671982 Original CRISPR GTTTTTAAGGATATAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr