ID: 915673451

View in Genome Browser
Species Human (GRCh38)
Location 1:157509730-157509752
Sequence CTCTGCGTGGGAAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915673451_915673457 -2 Left 915673451 1:157509730-157509752 CCTTCTTCCCTTCCCACGCAGAG No data
Right 915673457 1:157509751-157509773 AGCTCATTCTATTTTTGGTGAGG No data
915673451_915673458 3 Left 915673451 1:157509730-157509752 CCTTCTTCCCTTCCCACGCAGAG No data
Right 915673458 1:157509756-157509778 ATTCTATTTTTGGTGAGGCCAGG No data
915673451_915673456 -7 Left 915673451 1:157509730-157509752 CCTTCTTCCCTTCCCACGCAGAG No data
Right 915673456 1:157509746-157509768 CGCAGAGCTCATTCTATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915673451 Original CRISPR CTCTGCGTGGGAAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr