ID: 915681664

View in Genome Browser
Species Human (GRCh38)
Location 1:157587277-157587299
Sequence CTGCACATGGATCTGTAGCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915681656_915681664 28 Left 915681656 1:157587226-157587248 CCCAAGGGGCAGAGAGAGGCAGG 0: 1
1: 0
2: 5
3: 58
4: 610
Right 915681664 1:157587277-157587299 CTGCACATGGATCTGTAGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 66
915681661_915681664 -2 Left 915681661 1:157587256-157587278 CCTGGCTCTCCAACACTCACGCT 0: 1
1: 0
2: 0
3: 7
4: 149
Right 915681664 1:157587277-157587299 CTGCACATGGATCTGTAGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 66
915681658_915681664 27 Left 915681658 1:157587227-157587249 CCAAGGGGCAGAGAGAGGCAGGG 0: 1
1: 0
2: 22
3: 100
4: 920
Right 915681664 1:157587277-157587299 CTGCACATGGATCTGTAGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915681664 Original CRISPR CTGCACATGGATCTGTAGCG AGG Exonic
910676409 1:89821038-89821060 CAGCACATGACTCTGTAACGAGG - Exonic
912249368 1:107994970-107994992 CTTCACATGGATCTGTATCTGGG + Intergenic
915511630 1:156389927-156389949 CTGCACCTGGATCTTTATAGAGG - Intergenic
915681664 1:157587277-157587299 CTGCACATGGATCTGTAGCGAGG + Exonic
1064023800 10:11830476-11830498 CTGCACTTGCATCTTTACCGCGG - Intronic
1071907746 10:90192795-90192817 CTTCACATGGAAATGTAGCCTGG + Intergenic
1075944767 10:126423174-126423196 CTGCACATGGCTATGTATGGTGG - Intergenic
1077699137 11:4423792-4423814 CTGCAACTGGACCTGTAGCCTGG - Intergenic
1078147588 11:8732193-8732215 CTGCATATGGATTTGGAGCTGGG - Intronic
1080682604 11:34490379-34490401 CTGCACAGGGATCAGTAGCCCGG - Intronic
1084084624 11:66849354-66849376 CTGCAGGTGGAGCTGGAGCGGGG - Exonic
1089813361 11:121149770-121149792 CTGCACCTGGATTTGTACCGTGG - Intronic
1095707488 12:45253322-45253344 CTGCAACTGGATCAGTGGCGGGG - Intronic
1099136803 12:78915237-78915259 CTGCAGATGCTTCTGTAGCAGGG - Intronic
1102225099 12:111223106-111223128 CTCCACAAGGATCTGTTGAGCGG - Intronic
1104384656 12:128339747-128339769 CTGCACATAGACCTGGAGCCAGG + Intronic
1104786445 12:131452719-131452741 CTGCACATGAATCAGGAGCTGGG + Intergenic
1106373134 13:29156855-29156877 TTGCACATGGCTCTGAGGCGGGG - Intronic
1108141482 13:47426944-47426966 CTTCACATGAATATGTAGCTTGG + Intergenic
1110417667 13:75269833-75269855 GTTCACATGGCTCTGTAGTGAGG - Intergenic
1119971012 14:78970724-78970746 CTGCACATAGAGCTGTAGATAGG - Intronic
1120524426 14:85561252-85561274 CTGTACATGTATCTGGAGAGAGG + Intronic
1122918756 14:104871002-104871024 CTGGACATGGGGCTGTAGGGTGG - Intronic
1124622194 15:31280094-31280116 CAGCACATGGAGCTGGAGCTGGG + Intergenic
1127794136 15:62424028-62424050 CTGCACAGGGATCTGAATCCTGG + Intronic
1129738231 15:77977368-77977390 CTGCTCATGGAGCTGTGGCATGG + Intergenic
1130254064 15:82317691-82317713 CTGCTCACGGAGCTGTGGCGTGG + Intergenic
1138284428 16:55797941-55797963 CAGCAGATGGATCTGTACCCAGG + Intergenic
1138284574 16:55799046-55799068 CAGCAGATGGATCTGTACCCAGG - Intergenic
1146673666 17:34758531-34758553 CTGCACAGGGCTCTGCAGCCTGG + Intergenic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1158626796 18:59078556-59078578 CTGGAAATGGATCTGCAGTGGGG + Intergenic
1160765019 19:803749-803771 TTGGACCTGGGTCTGTAGCGTGG - Intronic
1162044897 19:7992296-7992318 CTGCACATGGATGTTTACAGCGG + Intronic
1165064577 19:33221526-33221548 CTGTAAATGGAACTGTAGTGGGG + Intronic
933885859 2:86719415-86719437 CGGCACATGGCTCTGGGGCGAGG + Intronic
933924321 2:87077290-87077312 CGGCACATGGCTCTGGGGCGAGG - Intergenic
934130379 2:88942444-88942466 CTGCACTTGGATCTCCAGTGAGG - Intergenic
934132486 2:88962053-88962075 CTGCACTTGGATCTCCAGTGAGG - Intergenic
936069769 2:109358347-109358369 CTGCATATGGATGTTTAGAGTGG - Intronic
1178907391 21:36647979-36648001 CTGCACCTGGAACTGCAACGGGG - Intergenic
1182965396 22:34516723-34516745 CTGCACAAGGGTCTGTGGCGGGG + Intergenic
950070208 3:10146027-10146049 CTGTAAATGGATCTGTTGTGAGG + Intronic
959663022 3:108890521-108890543 CTGCACATGTGGCTGCAGCGAGG - Intergenic
967948440 3:194822469-194822491 CTGCACCTGCATCTGTGCCGTGG - Intergenic
968227520 3:196983645-196983667 ATGCACATGTATGTGTAGCCAGG - Intergenic
973168908 4:47114048-47114070 CTGCATATGCATCTCTAGCTTGG - Intronic
974284777 4:59850102-59850124 CTGCCCATGGATCTGGAGCTAGG + Intergenic
974345685 4:60678008-60678030 CAACACATGAATTTGTAGCGTGG + Intergenic
984313572 4:178096846-178096868 TTGCACATGGATGTGTAAAGTGG + Intergenic
985520769 5:373170-373192 CTGAACCCGGATCTGTAGCCTGG - Intronic
989944920 5:50211723-50211745 CTGCAAATGGATATGTGGAGAGG - Intergenic
994874211 5:105394019-105394041 CTGCACATTGATCTGGAGAAAGG + Intergenic
1001048549 5:168395221-168395243 CTGGACATGGGTCTGTACTGTGG - Intronic
1004764353 6:18708862-18708884 CTGTACATGAATCTGTAGAGAGG - Intergenic
1004891072 6:20101277-20101299 CTGTACATGGAGCTGAAGAGGGG - Intergenic
1014358759 6:120447402-120447424 ATGCACATGGGTCTTTAGCTGGG + Intergenic
1036627654 8:10484622-10484644 CAGCACATGGATCTGTATTGGGG + Intergenic
1040729856 8:50430945-50430967 CTGCACATGGAACTGTATTCTGG - Intronic
1041942691 8:63406084-63406106 CTGCACATGGTTTGGTAGAGAGG - Intergenic
1043739658 8:83794846-83794868 CTGCACATGGATCTTTTTAGTGG + Intergenic
1044542713 8:93425744-93425766 CTGCTCATGGTTCTGTAGGCTGG + Intergenic
1047612258 8:126532685-126532707 CTGTACATGGAACTGCAGCAGGG + Intergenic
1049495654 8:142930703-142930725 CTGCACTTGTATCTGGAGAGTGG + Intergenic
1049689177 8:143951269-143951291 CTTCACAAGGATCTGAAGGGGGG + Intronic
1049846964 8:144807442-144807464 CCGCACACGCACCTGTAGCGGGG - Exonic
1051030473 9:12669121-12669143 CTTCACATGGATCTGGGGCAAGG + Intergenic
1053305178 9:36979862-36979884 CTGCACAAGGAGCTGTAGACAGG - Intronic
1055693909 9:78862299-78862321 CTGCACCTTGATCTGTATGGTGG - Intergenic
1056428653 9:86504782-86504804 CTTCACATGGATCTATGGCTGGG - Intergenic
1057325099 9:94055387-94055409 CTGCACATGAATGTGTATAGCGG + Intronic
1193085015 X:77441210-77441232 CTGCATTTGAAGCTGTAGCGAGG - Intergenic
1194509279 X:94772600-94772622 CTTCACATGGCTCTGTGGGGTGG - Intergenic
1196282200 X:113834970-113834992 GTGCACATGGATTTGTAGACAGG + Intergenic