ID: 915682329

View in Genome Browser
Species Human (GRCh38)
Location 1:157593363-157593385
Sequence AAGCTGAGCCCACCAAAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915682329 Original CRISPR AAGCTGAGCCCACCAAAGTT AGG (reversed) Intronic
900546586 1:3232816-3232838 AATCTGACCTCCCCAAAGTTGGG - Intronic
901492569 1:9603855-9603877 AAGCTGAGCCCAGTAACGCTGGG - Intronic
902270577 1:15301511-15301533 AAGGTGAGCCACCCAGAGTTAGG + Intronic
902377977 1:16039136-16039158 AAGCTGGTCCCACCACAGCTTGG - Intergenic
905818628 1:40971876-40971898 AACCTCAGCCTACCAAAGCTGGG - Intergenic
905902018 1:41588022-41588044 AAGGGGAGCCCAGCAAAGGTCGG + Intronic
907128947 1:52077796-52077818 ATGCAGAGCCCAGCAAAGGTAGG + Intronic
907230628 1:52995359-52995381 AAGCTGACCACACCAAACTATGG + Intronic
912040371 1:105383014-105383036 AAGCTGTGGCCAACACAGTTGGG + Intergenic
913036278 1:114969383-114969405 AAGCAGAGCCCACCACAGCATGG - Intronic
915682329 1:157593363-157593385 AAGCTGAGCCCACCAAAGTTAGG - Intronic
917285171 1:173415617-173415639 GAGCTGAGAACACCAAAGTCAGG - Intergenic
918084326 1:181232334-181232356 GAACTGTGCCCACCTAAGTTAGG + Intergenic
921505543 1:215964323-215964345 AAGCTGATCCCCTCAAAGATTGG - Intronic
922111216 1:222557723-222557745 AAGCCGAGCCCTTTAAAGTTAGG + Intergenic
923086718 1:230708120-230708142 AAACTGAGGCCAGCAAAGTTAGG + Intronic
1072493677 10:95934123-95934145 AGGCAGAGCCCACCACAGCTTGG - Intronic
1072796029 10:98355190-98355212 ATGCTGAGCTCACCATAGCTAGG - Intergenic
1077066832 11:644799-644821 GAGCAGAGCCCACCAGAGTTTGG - Intronic
1077918398 11:6625675-6625697 TAGCTGAGCCCACCAGGGCTGGG + Exonic
1078853850 11:15190402-15190424 TTGCTGAGCCCATCAATGTTGGG + Intronic
1079915815 11:26367243-26367265 AAGAAGAGCCCATAAAAGTTTGG - Intronic
1080344171 11:31303911-31303933 AAGCTTAACCCACCAAAATCTGG - Intronic
1081185248 11:40034715-40034737 AAGATGTGCTCACCAAGGTTAGG + Intergenic
1081338843 11:41902787-41902809 CACCTGAGCCCACCCATGTTGGG + Intergenic
1083478733 11:62930077-62930099 AAGCTGAGCCTAGGAAATTTGGG - Intergenic
1087493105 11:98852537-98852559 ATGCTGAGCTCAACAAAGTATGG - Intergenic
1090729803 11:129560262-129560284 AATCTGAGTGCACCAATGTTAGG - Intergenic
1091100745 11:132870842-132870864 AAGCTGAACACACAAAAGTAGGG + Intronic
1093805426 12:23426819-23426841 AAGGTGAGCCCACAAAGGTTGGG + Intergenic
1094151052 12:27283890-27283912 TAGCTGTGCGCCCCAAAGTTAGG - Intronic
1096502156 12:52070579-52070601 AAGCAGGGCCCACCAGAGTAGGG - Intronic
1098368751 12:69735643-69735665 GAGCTTAGGCCACCAGAGTTAGG - Intergenic
1100776066 12:97976085-97976107 AAAAAGAGCCCAGCAAAGTTAGG - Intergenic
1100883035 12:99039443-99039465 CAGCTGAGCCCTCCGAAGTCAGG + Intronic
1102933597 12:116879909-116879931 AGGCTGAGCCCACCATAGATGGG - Intronic
1103739529 12:123081871-123081893 CACCTGAACCCACCAAAGCTGGG + Intronic
1106101779 13:26699415-26699437 AAGCTGAGCTCAGTAAGGTTGGG - Intergenic
1107341029 13:39406029-39406051 TAGCTGAGCTCACCAGAGTTCGG + Intronic
1111904634 13:94240929-94240951 GAGCTGAGTCCACCATACTTGGG + Intronic
1114184641 14:20391216-20391238 AAGCTGACCCCTCCTAACTTGGG - Intronic
1115731715 14:36276350-36276372 AAATTGAGCTCACCAAATTTTGG - Intergenic
1126868294 15:52959987-52960009 AAGCAGTGCCCTCCAAAGTCGGG + Intergenic
1130106615 15:80933220-80933242 AAACAGAGCCCAGGAAAGTTAGG - Intronic
1131177969 15:90221615-90221637 AGGCTGAGGCCACAAAAGCTGGG - Exonic
1133993529 16:10729427-10729449 AGGCTGAGCCCTCCAAGGTCGGG - Intergenic
1138832668 16:60393921-60393943 AAGCTCAGCCCATCAAGATTGGG + Intergenic
1142703546 17:1679416-1679438 AAAATAAGCCCACCAGAGTTTGG + Intronic
1150920990 17:69482112-69482134 AAATTGAGTCCACAAAAGTTAGG + Intronic
1152260318 17:79263187-79263209 AGCCTGAGCCCTCCAAAGGTTGG - Intronic
1163459833 19:17430333-17430355 AAGCTCAGCCCAGAAATGTTAGG - Intronic
1164321678 19:24153723-24153745 AACCTGATCCAACCAATGTTTGG + Intergenic
1168130927 19:54318084-54318106 CAGCTGAGCCCACCCAAGCTGGG + Intergenic
927318887 2:21719968-21719990 AATCTGGGCCGAGCAAAGTTTGG + Intergenic
930296999 2:49567198-49567220 AAACTGAGCCCACCATATTGTGG + Intergenic
936280428 2:111135525-111135547 AAGCTGACCCCACCAGGGGTGGG + Intronic
938781139 2:134585992-134586014 AAGAAGAGCCCAACAAAGTCTGG + Intronic
940614535 2:156033844-156033866 AAGCTGGACCAACCAAAGGTTGG - Intergenic
1170454617 20:16520425-16520447 GAGCAGAGCCCACCACAGCTTGG + Intronic
1171324927 20:24282826-24282848 CAGCTGAGTCCACCCAAGCTGGG - Intergenic
1174950459 20:55036144-55036166 CAGCTGAGCCCACCCAAGCCAGG - Intergenic
1175767637 20:61602173-61602195 CAGCTGAGCCCTCCCAGGTTAGG + Intronic
1178709845 21:34906880-34906902 AAGCAGAGCCCATCTCAGTTTGG + Intronic
1179198372 21:39188081-39188103 TATCTGAGCCCTCCTAAGTTTGG - Intronic
1179414354 21:41186232-41186254 AAGCTGAGCACCCCCAAGCTGGG - Intronic
1181075689 22:20375213-20375235 AAGCTTATTCCACCACAGTTAGG - Intronic
1183190957 22:36321905-36321927 AAGCTGTGCCCACCGGAGGTGGG - Intronic
1183362584 22:37390422-37390444 AAGCTGAACCCACCAAAGGGTGG + Intronic
1183630537 22:39029951-39029973 AATCTGATCCCAGGAAAGTTAGG - Intronic
1183633993 22:39050043-39050065 AATCTGATCCCAGGAAAGTTAGG - Intronic
1184345133 22:43908560-43908582 GAGCTGAGCCCATCTAAGATAGG - Intergenic
1185071382 22:48658642-48658664 AAGCTGAGCCCCACAAAGGGTGG + Intronic
949575543 3:5335447-5335469 AAGCTGAGATTACCAAAGTGAGG - Intergenic
950130728 3:10544576-10544598 AATCTGAGCCTCCCAAAGTGTGG - Intronic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
953052908 3:39362069-39362091 AGGCTGAGCCCACCTGAGATAGG + Intergenic
956787774 3:72656453-72656475 GAGCTGAGCCCTCTAAAGGTGGG + Intergenic
959774600 3:110141813-110141835 AAGCATGACCCACCAAAGTTCGG - Intergenic
961704162 3:128771305-128771327 AAGATGAGCCCCCCAAACTGAGG - Intronic
965510908 3:169566969-169566991 AAGTTGAGCCCAGAGAAGTTTGG - Intronic
965781437 3:172290066-172290088 AAGCAGAGCCATGCAAAGTTGGG + Intronic
966758760 3:183396021-183396043 ATACTGAGCCCTCCAAAGTGAGG - Intronic
967765456 3:193274401-193274423 AAGCAAATTCCACCAAAGTTTGG - Intronic
972477603 4:39465905-39465927 CACCTGAGCCTACCAAAGTGCGG + Intronic
977887903 4:102273342-102273364 GAGCGGAGCCCACCACAGCTCGG + Intronic
981265475 4:142777976-142777998 CAGCAGAGCCCATCTAAGTTTGG + Intronic
982367043 4:154590636-154590658 ATGCTGTGCCCACCACACTTAGG + Exonic
987291300 5:16511115-16511137 AAGTTGAGCCATCCTAAGTTGGG - Intronic
993686574 5:90945309-90945331 AGACTGAGCCCACCAAAACTAGG + Intronic
1000470122 5:161630511-161630533 AAGCTTAGCCCACCATAATTAGG - Intronic
1001272529 5:170325812-170325834 AAGCTGAGACCACTAACCTTGGG + Intergenic
1003539206 6:7003292-7003314 AGGCCCAGCACACCAAAGTTTGG + Intergenic
1006452552 6:34113556-34113578 AAGCTCAGCCCAACCAAGCTGGG - Intronic
1007431582 6:41780137-41780159 GGGCTGAGGACACCAAAGTTGGG + Intronic
1008588585 6:52970781-52970803 AAGCTGCTCCCACCTCAGTTTGG - Intergenic
1009335129 6:62478341-62478363 AAGCAAGGCCCATCAAAGTTAGG - Intergenic
1010881970 6:81187583-81187605 AAGATGAGGGAACCAAAGTTTGG + Intergenic
1011044170 6:83064187-83064209 AAACTAAGTCCAGCAAAGTTAGG + Intronic
1011387664 6:86815376-86815398 AAGAGGAGCCCACCACAGCTTGG - Intergenic
1013465035 6:110410608-110410630 GAGCTGAGCTCAGCAAAGTGGGG + Intronic
1013672641 6:112421774-112421796 GAGTGGAGCCCACCAAAGCTTGG + Intergenic
1013707512 6:112855845-112855867 AACCTGAATCCACAAAAGTTAGG - Intergenic
1014934091 6:127365993-127366015 CAGCTGAGCCCACTCAAGCTGGG - Intergenic
1015471891 6:133615008-133615030 ATGCTGAGCCCACCAAAGCTTGG + Intergenic
1018220158 6:161569888-161569910 CAGCTGAGCCCCCCAAAGAATGG - Intronic
1019456451 7:1130273-1130295 CAGCTGAGGCCACCAGACTTGGG + Intronic
1020698823 7:11451095-11451117 AAGCTTAGCCCATCAATATTGGG + Intronic
1022139499 7:27481130-27481152 AAGTTGAGCCATCCTAAGTTGGG + Intergenic
1022527616 7:31048658-31048680 AAGCTCAGCCCCCCTAAGCTGGG - Intergenic
1026465654 7:70651712-70651734 AAGCTGAGCCATCGGAAGTTAGG + Intronic
1027495355 7:78881042-78881064 AATCTGAGTCCTCCAATGTTGGG - Intronic
1031299099 7:120042044-120042066 AATCTGAGACCACCACAGTCTGG - Intergenic
1035299252 7:157886750-157886772 CAGCTGAGCCCACCACAGTGGGG + Intronic
1035696767 8:1603693-1603715 ATGCTGAGCCCATCACAGTGTGG - Intronic
1039422043 8:37451320-37451342 AAGGTGAGCTCACCTCAGTTTGG + Intergenic
1040802493 8:51358720-51358742 AAGATGAGCACCCCAAAGATGGG + Intronic
1041838633 8:62245121-62245143 AAACTGAACCCCCAAAAGTTGGG + Intergenic
1044597879 8:93976236-93976258 ATGCAGAGCCCACCAAAAATAGG - Intergenic
1045142588 8:99302916-99302938 AAGTTGAACCAACCTAAGTTGGG + Intronic
1045392985 8:101733624-101733646 ACGATGAGCCCTCCAGAGTTGGG + Intronic
1047612864 8:126538193-126538215 CAACTGAGCCCACCACAGTTAGG - Intergenic
1047754836 8:127910373-127910395 CAGATGAGGACACCAAAGTTTGG - Intergenic
1048925236 8:139265434-139265456 AAGCTTTGCCCACCCAAGCTGGG - Intergenic
1049530621 8:143152882-143152904 TAGCTGAGCCCTCCAAAGCATGG - Intergenic
1053125227 9:35575711-35575733 CAGCTGAGCCCACCCAAGCTGGG + Intergenic
1055516353 9:77037413-77037435 AAGCTGATTCCTCCAGAGTTAGG + Intergenic
1057028158 9:91752084-91752106 AGGCTGACCACACCAATGTTGGG + Intronic
1062127005 9:134869360-134869382 AAGCTGAGCCCACAAAACCGTGG + Intergenic
1189417702 X:40829697-40829719 AAGCTGACCCCATCAAACCTAGG - Intergenic
1189929065 X:45988692-45988714 AAGCTGAGCACATAGAAGTTTGG - Intergenic
1191824864 X:65353860-65353882 GGGCAGAGCCCACCACAGTTTGG + Intergenic
1192938000 X:75881392-75881414 GGGCAGAGCCCACCACAGTTTGG - Intergenic
1196717108 X:118822874-118822896 AATCTGAATCCACCAGAGTTGGG + Intergenic
1200022701 X:153225615-153225637 AAGCTGAGCCAACCACAGTAAGG - Intergenic