ID: 915682341

View in Genome Browser
Species Human (GRCh38)
Location 1:157593519-157593541
Sequence ATAACTAGGCCTCAAGTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 10, 2: 33, 3: 67, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915682341_915682345 20 Left 915682341 1:157593519-157593541 CCTCTTACTTGAGGCCTAGTTAT 0: 1
1: 10
2: 33
3: 67
4: 106
Right 915682345 1:157593562-157593584 ATGCATGGGCTGTATCTAATTGG 0: 1
1: 0
2: 0
3: 6
4: 94
915682341_915682344 6 Left 915682341 1:157593519-157593541 CCTCTTACTTGAGGCCTAGTTAT 0: 1
1: 10
2: 33
3: 67
4: 106
Right 915682344 1:157593548-157593570 TCTTGAAAACATGTATGCATGGG 0: 1
1: 2
2: 5
3: 50
4: 275
915682341_915682346 30 Left 915682341 1:157593519-157593541 CCTCTTACTTGAGGCCTAGTTAT 0: 1
1: 10
2: 33
3: 67
4: 106
Right 915682346 1:157593572-157593594 TGTATCTAATTGGCTGTATGAGG 0: 1
1: 0
2: 0
3: 13
4: 151
915682341_915682343 5 Left 915682341 1:157593519-157593541 CCTCTTACTTGAGGCCTAGTTAT 0: 1
1: 10
2: 33
3: 67
4: 106
Right 915682343 1:157593547-157593569 ATCTTGAAAACATGTATGCATGG 0: 1
1: 0
2: 4
3: 29
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915682341 Original CRISPR ATAACTAGGCCTCAAGTAAG AGG (reversed) Intronic
905223584 1:36465453-36465475 ATAACTGGTCCTCAAGCAAGAGG - Intergenic
906807007 1:48788983-48789005 ATTACTGGGGATCAAGTAAGGGG - Intronic
907363246 1:53938485-53938507 ACAACTACGCTTCAAGGAAGAGG + Intronic
907803359 1:57793799-57793821 ATCACTAGGCTTTTAGTAAGAGG + Intronic
908901955 1:68965776-68965798 ATTACTAGCCCTAAAGTAGGAGG + Intergenic
911817501 1:102371701-102371723 ATAACTAGTCCTCAAATAAGAGG - Intergenic
911933610 1:103937339-103937361 ATAACTAGGCCTCAAATAAGAGG + Intergenic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
915682341 1:157593519-157593541 ATAACTAGGCCTCAAGTAAGAGG - Intronic
917277555 1:173346943-173346965 ATAACTAGTATTCAAGTAAGAGG + Intergenic
917540114 1:175903757-175903779 ATCACTAGTCCTCAAGTTAGAGG + Intergenic
917700325 1:177574108-177574130 ATTATTATGCCTCAATTAAGGGG + Intergenic
918797150 1:188915115-188915137 ACAGCTAGTCCTCAAGTAAGAGG + Intergenic
918856624 1:189763721-189763743 ATAACTAGTCCTCATGTTAGAGG - Intergenic
919358603 1:196560791-196560813 ATAACCAGTCCTCAAGGAAGAGG - Intronic
919953481 1:202389170-202389192 ATAACTAGGAAGCAAGGAAGAGG + Intronic
923059139 1:230454381-230454403 ATAACTAGTTTTCAAGTAACAGG - Intergenic
923872342 1:238009351-238009373 ATAAATAGTCCTCAAATTAGAGG + Intergenic
924182943 1:241457357-241457379 ATAACTAGTCTTCAAATAAGAGG + Intergenic
1066695792 10:38076567-38076589 ATAAATAGGCCAAAAGAAAGGGG + Intergenic
1068129747 10:52882809-52882831 ATAACTAGTCCTCAAGTAAGAGG - Intergenic
1068489557 10:57705977-57705999 ATAACTAGTCTTCAAGTAAGAGG + Intergenic
1069106830 10:64393631-64393653 ATAACTAGTCTTCAAGTAAGAGG + Intergenic
1069135892 10:64765244-64765266 GTAACTCGTCCTCAAGTAAAAGG - Intergenic
1069323821 10:67206207-67206229 ATAACTATTCCTCAAGTAAGAGG - Intronic
1069921261 10:71817088-71817110 AGAACAAGGCCTCAACCAAGAGG + Exonic
1073317279 10:102592015-102592037 AACACTAGGCTTCAAGTAAATGG - Intronic
1073711211 10:106044722-106044744 ATCACTAATCCTCAAGGAAGAGG - Intergenic
1073798058 10:107010387-107010409 GTAACTAGGCCTCAACTCAGTGG - Intronic
1074202870 10:111255411-111255433 AGAACTAGCCATCAAGAAAGTGG - Intergenic
1074429265 10:113379695-113379717 ATAACTCAGCCTCAAGGAAGAGG - Intergenic
1076208565 10:128622953-128622975 TAAACTAGGACTCAAGCAAGGGG + Intergenic
1081011984 11:37825015-37825037 AAAACTAACCCTCAAGTAAGAGG + Intergenic
1082194603 11:49287170-49287192 ATAACTAGTCTTCGAGTAAGAGG - Intergenic
1086671525 11:89553759-89553781 ATAACTAGTCTTCGAGTAAGAGG + Intergenic
1087415840 11:97854406-97854428 GTAAGTAGTCCTCAAGTAAGAGG - Intergenic
1087987817 11:104706713-104706735 ATAACTAGTTGTCAAGTAAGAGG + Intergenic
1089266637 11:117268081-117268103 ATTGTTAGTCCTCAAGTAAGAGG + Intronic
1089671401 11:120059497-120059519 GAAACTAGTCCTCAAGGAAGAGG + Intergenic
1093077202 12:14770560-14770582 AGAACTAGACCTCAAGGAGGGGG - Exonic
1094243843 12:28263083-28263105 AAAAATAAGACTCAAGTAAGTGG - Intronic
1095364992 12:41392598-41392620 ATAACTAGGATGTAAGTAAGGGG - Intronic
1097568512 12:61300852-61300874 ATAACTAGTTCTCAGGAAAGAGG - Intergenic
1097634374 12:62104677-62104699 ATAACTAGTCCTCAACTAAGAGG + Intronic
1097765184 12:63518310-63518332 ATAACTAGTCTTCAAGTAAGAGG + Intergenic
1098102499 12:67033145-67033167 ATAATTAGGCGGCAAGAAAGAGG - Intergenic
1098640536 12:72833624-72833646 ATAACTAGTCTTTAAATAAGAGG - Intergenic
1101937343 12:109069199-109069221 ACAACTAGGCCTTAAGGAAAGGG - Intronic
1104878439 12:132052929-132052951 AGAGCTCGGCCTCAAGGAAGAGG + Intronic
1105026562 12:132853071-132853093 ATATCTGTCCCTCAAGTAAGAGG - Intronic
1106215008 13:27689089-27689111 ATAACTTGACCTAAAATAAGAGG - Intergenic
1109505217 13:63291827-63291849 ATAATTACTCCTCAAGTAAGAGG + Intergenic
1109799519 13:67358119-67358141 AACACTAGGCTTCCAGTAAGTGG + Intergenic
1109821977 13:67668817-67668839 ATAACTAGACCTAAAATAAGAGG - Intergenic
1110744456 13:79036710-79036732 ATAACTAGTCTTGAAGTAAGAGG + Intergenic
1111190584 13:84801509-84801531 ATCATTAGTCTTCAAGTAAGAGG - Intergenic
1111220061 13:85193512-85193534 TGAACTAGGCCTCAAGTGATAGG - Intergenic
1111252356 13:85619330-85619352 ATAACTAGTCCTCAAGAAAGAGG + Intergenic
1111484132 13:88872932-88872954 ATAACTTGCCCTCAAGTAAGAGG - Intergenic
1112648539 13:101364511-101364533 ATATTTAGGCCTTAAGTAAGTGG + Intronic
1112961355 13:105131321-105131343 ATGCCTAGGCCTTAAGTGAGAGG + Intergenic
1113829090 13:113280770-113280792 ATAACTTGACCTGATGTAAGTGG - Intergenic
1114376411 14:22151425-22151447 ATAACTAGTCCGCAAGAAAGAGG - Intergenic
1114426482 14:22628168-22628190 ACAACTAGTCCTCAAGTAAAAGG - Intergenic
1115675361 14:35667522-35667544 TTAACTAGATCACAAGTAAGTGG - Intronic
1116051489 14:39808801-39808823 ATAACTAGTCTTCAGCTAAGAGG - Intergenic
1116171105 14:41403804-41403826 GTAACTAGTCCTCAAGTAAGAGG - Intergenic
1116277962 14:42861030-42861052 ATAACTAGTCCTCAAGTCAGAGG + Intergenic
1116322268 14:43483540-43483562 ATAACTAGTCTTCAAGTAAGAGG + Intergenic
1116460520 14:45167582-45167604 GTAACTTGTCCTCATGTAAGAGG + Intronic
1116589102 14:46748339-46748361 GTAACTAATCCTCAAGTAAGAGG + Intergenic
1116771719 14:49133890-49133912 ATAATTAGTCCTCAAGCAAGAGG + Intergenic
1118989128 14:70782059-70782081 ACAATTAGGCCTCAAAGAAGGGG - Intronic
1123873417 15:24598939-24598961 ATATGTAGACCTCAAATAAGGGG - Intergenic
1127042180 15:54989184-54989206 ATAACTAGTCCTCAAGTAAGAGG - Intergenic
1128178110 15:65574875-65574897 ATAACTAGGCCCCATGAAATGGG + Intronic
1133946337 16:10351837-10351859 ATAACTTGTCCCCAAGTAAGAGG + Intronic
1136241612 16:28948076-28948098 ATGACTAGTCCTCACGTAAGAGG + Intergenic
1137014616 16:35362709-35362731 ATAGCTAGGCTTCAAGCAATGGG + Intergenic
1147674491 17:42195259-42195281 ATAACGAGTCCTCAAGTAAGAGG + Intergenic
1150165852 17:62942000-62942022 ATAACTTGGCCTCAAATGATGGG - Intergenic
1154025421 18:10703205-10703227 TTACCTAGGGCTGAAGTAAGAGG - Intronic
1155915466 18:31552945-31552967 ATAGCTTGTCCTCAAGTCAGAGG + Intergenic
1156905256 18:42344813-42344835 ATAATTAGTCCTCCAGTAAGAGG - Intergenic
1158842866 18:61407037-61407059 ATAACTGCTCCTCAAGTAAGAGG + Intronic
1159447549 18:68559015-68559037 ATAATTAGCCCTCAAGTAAAAGG - Intergenic
1159502561 18:69292995-69293017 ATAACTAGTCCTCAAATAAGAGG + Intergenic
1159549988 18:69884804-69884826 ATAACTAGTCTTCAAGTAAGAGG - Intronic
1159879535 18:73845361-73845383 ATAACCAGTCCTCAAGTAAGAGG + Intergenic
1167987202 19:53328641-53328663 ATAGCTAGTTCTCAAGTAAGAGG - Intergenic
1168663444 19:58184616-58184638 ATAAATTGGCATCAAGCAAGAGG + Intronic
930966066 2:57328391-57328413 ATAACTAGTCCTCAAATAAGAGG - Intergenic
932916964 2:75870057-75870079 ATAACTAGTCTTCAAGTAAGCGG + Intergenic
933081674 2:77996292-77996314 TTAGCTATGCCTCAAGTAATAGG - Intergenic
933283798 2:80361960-80361982 ATAACTAGTCCTCTAGTAAGAGG + Intronic
935329189 2:101963908-101963930 ATAATCAGTCCTCAAGAAAGAGG + Intergenic
937605163 2:123791723-123791745 ATAGCTAGGCATCATATAAGAGG + Intergenic
939431074 2:142108866-142108888 ATAACTAGGTCTCAGGTGTGTGG - Intronic
939573674 2:143870113-143870135 AAAAATAAGCCTCAAGGAAGAGG + Intergenic
939638161 2:144607966-144607988 AGAACTAGGCGTCAAGTCGGAGG + Intergenic
940768504 2:157815957-157815979 ATCACCAGTCCTCAAGTGAGAGG - Intronic
941399580 2:165014276-165014298 ATGACTAGGACTCAAGAATGAGG - Intergenic
943132569 2:183872703-183872725 ATAACTAGTCCTCAAGTAAGAGG - Intergenic
945324562 2:208467521-208467543 ATAACTAGTTCTCAAGTAAAAGG + Intronic
945411854 2:209519281-209519303 ACAACCAGTCCTCAAGTAAAAGG + Intronic
947282556 2:228471711-228471733 ATAACTATTTCTCAAGTAAGAGG - Intergenic
948198180 2:236110568-236110590 ATAAAAAAGCCTCAAGTCAGTGG + Intronic
1170036451 20:11995017-11995039 ATAACTAGTGCTCAAGCAAGAGG - Intergenic
1173484477 20:43430363-43430385 AGTCCTAGGCCTGAAGTAAGAGG + Intergenic
1173637408 20:44572616-44572638 ATCTCTGGGCTTCAAGTAAGTGG - Intronic
1177182705 21:17760166-17760188 ATAACTAGTCTTCAAGTGAGAGG - Intergenic
1177520199 21:22211460-22211482 GTAACTAGTTCTCAAGTAAGAGG + Intergenic
1179538290 21:42066751-42066773 ATAACTAGTCCTTAAGGAAGAGG - Intronic
951858021 3:27219411-27219433 ATAACTAGTCTTCAAGCAAGAGG - Intronic
953043504 3:39275509-39275531 ATAACTGTTCCTCAAGTAAGAGG - Intronic
953064185 3:39454384-39454406 ATAGCTAGTCCTCTAGCAAGAGG + Intergenic
953640189 3:44700027-44700049 ATAACTAGTCTTCAAATAAGAGG + Intergenic
956303665 3:67800612-67800634 ATTACTAGGCCTAAAGAAAGAGG - Intergenic
956980433 3:74630165-74630187 ATAACTAAGCCTAAAGTCAATGG + Intergenic
957784400 3:84863149-84863171 ATAACTAGTCTTCAAGTAAGAGG + Intergenic
958868428 3:99528320-99528342 ATAATTAAGGATCAAGTAAGAGG - Intergenic
959137446 3:102441766-102441788 ATAACTAGTCCTCAAGTAAGAGG + Intronic
960912733 3:122665486-122665508 ATAACTAGCCCTCAAGTAAGAGG - Intergenic
961909888 3:130303462-130303484 ATAACCAGATCTCAAGTAAGGGG + Intergenic
962276613 3:134019435-134019457 ATAACTATGCCTCACGGAATTGG + Intronic
963481996 3:145887690-145887712 GTAACTAGTCCTCAAGTAAGAGG + Intergenic
965196399 3:165601996-165602018 ATAACTAATCATCAAATAAGAGG - Intergenic
966036425 3:175422741-175422763 AAAACTAGTCATCAGGTAAGAGG + Intronic
971996401 4:33971078-33971100 ATAGCTAGTCCTCTAGTAAGAGG - Intergenic
972107013 4:35501322-35501344 ATGACTAGCCCTCAAGTTAGAGG + Intergenic
972880391 4:43416010-43416032 ATAACTAGTACTCAAGTAAGAGG - Intergenic
974126184 4:57698714-57698736 AGAACTAAGCCTGAAGTGAGAGG - Intergenic
975221755 4:71820634-71820656 ATAACTAGTCCTCAAGTAAGAGG + Intergenic
976782467 4:88776343-88776365 ACAACTAGGTCACACGTAAGTGG - Intronic
980037098 4:127897617-127897639 ATAACTATGTTTCAAGTGAGAGG + Intronic
980222137 4:129931171-129931193 ATAACTAGCTCTCAAATAAGAGG - Intergenic
980278227 4:130683636-130683658 ATAATTAGTTCTCAAGTAAGAGG + Intergenic
980279067 4:130694356-130694378 ATAACTAGTGCTCAAGTAAGAGG + Intergenic
980589825 4:134871068-134871090 ATGACTAGTCTTCAAGTAAAAGG + Intergenic
980662442 4:135881011-135881033 ATAACTAGTGCTCAAATAAGAGG + Intergenic
980716027 4:136631111-136631133 ATAACTAGTCTTCAAGTAACAGG + Intergenic
980723993 4:136734525-136734547 GTAACTAGTCCTCAAGTAAGAGG - Intergenic
982975599 4:162055014-162055036 ATAACTAGTTATCAAGTAACTGG - Intronic
983082445 4:163403252-163403274 ATAACTATTCCTCAAGCAAGAGG - Intergenic
984028076 4:174569369-174569391 ATCATTAGTCCTCAAGTAAGAGG + Intergenic
984258111 4:177411044-177411066 ATAACTAGTCCTAGAGTTAGAGG - Intergenic
984280517 4:177664593-177664615 ATAACTAGTCCTCAAATCAAAGG - Intergenic
986509514 5:8489406-8489428 ATAACTAGTCCTCAAGAAAGAGG - Intergenic
987842447 5:23238339-23238361 ATAAGTAGTCCTCAAGTATGAGG - Intergenic
988412448 5:30904534-30904556 ATGACTAGGAGTCAAGTGAGAGG + Intergenic
989752042 5:44906675-44906697 ATTAATAGTCCTCAAGTAAGAGG - Intergenic
991466432 5:66917622-66917644 TTAACTAGGACTTAAGTAACTGG - Intronic
992152292 5:73917092-73917114 ATGCCTAGGCCTTAACTAAGGGG + Intronic
994040338 5:95252128-95252150 ATGACTAGTCCTCAAGGAAGGGG + Intronic
994605268 5:101959285-101959307 ACAACTCGTCCTCAAGTAAGAGG + Intergenic
994625473 5:102213654-102213676 ATAACTAGTTCCCCAGTAAGAGG + Intergenic
995142130 5:108747094-108747116 ATAACTAGTCCTCAAGTAAGAGG + Intergenic
995406336 5:111800870-111800892 ATAATTAGTCCTCAAGTAAGAGG + Intronic
996064511 5:119066683-119066705 ATAACTAAGCCTAAATCAAGGGG - Intronic
996261709 5:121479088-121479110 GTAACTAGTCCTTAAGTAGGAGG - Intergenic
996482933 5:123996037-123996059 ATAAGTAGGCCTGAAGAGAGGGG + Intergenic
998773570 5:145573278-145573300 ATAACTAGTCCCCAAATAATTGG + Intronic
1005285459 6:24321911-24321933 AAAACTAGTCTTCAAGAAAGAGG - Intronic
1008279620 6:49580674-49580696 AAAACTAGTCCTTAAATAAGAGG - Intergenic
1008747453 6:54690005-54690027 GTAACCAGCCCTCAAATAAGAGG - Intergenic
1010275255 6:73961675-73961697 ATAACTAGTCCTTAAGTAAGAGG - Intergenic
1011936281 6:92782359-92782381 ATAACTAGGTTTTAAGTGAGTGG - Intergenic
1012300975 6:97587578-97587600 ATAAATAGGTCCCAAGTATGTGG - Intergenic
1012738470 6:102981674-102981696 ATAACTAATCCCCATGTAAGGGG + Intergenic
1012804162 6:103874484-103874506 ATTGCTAGTCCTCAAGTAAGAGG + Intergenic
1012881006 6:104789980-104790002 CTAACTAGAGCTCAAGGAAGTGG + Intronic
1013824952 6:114200339-114200361 ATAACTAGTTCTCAAATGAGAGG - Intronic
1014386448 6:120808137-120808159 AAAACTAGTCCACAGGTAAGAGG - Intergenic
1014606462 6:123479613-123479635 ACAACTAGGACCCAAGTATGCGG + Intronic
1015389377 6:132664042-132664064 ATAACTAGTGCTTATGTAAGAGG - Intergenic
1016914404 6:149231771-149231793 ATCTCTGGTCCTCAAGTAAGAGG + Intronic
1017305880 6:152917800-152917822 ATAACTAGCCATCAAGTAAGAGG - Intergenic
1018013821 6:159694407-159694429 ATGACTAGGCTTCCGGTAAGTGG + Intronic
1024402585 7:48942361-48942383 ACAACTAGTACTCAAGTAAGAGG + Intergenic
1028488341 7:91384338-91384360 ACAACTAGGCCCCAAGAAGGAGG - Intergenic
1029983210 7:104898368-104898390 GTAACTAGTCCTCAAGTAAGAGG + Intronic
1030468704 7:109936229-109936251 ATAACTTGTCCTCAAGTAAGAGG - Intergenic
1030906942 7:115197345-115197367 GTCAATAGGCATCAAGTAAGAGG + Intergenic
1031190249 7:118540067-118540089 ATAACCAGTCTTCAAGTAATAGG + Intergenic
1033022214 7:137737588-137737610 ATGCCTTGGGCTCAAGTAAGAGG - Intronic
1033832842 7:145274403-145274425 ATAACTAGTTCTCAAATAAGAGG + Intergenic
1034385331 7:150736412-150736434 ATAACTAATCCTCAAGTAAGAGG - Intronic
1037266716 8:17071109-17071131 AAAGCTAAGCCTCAAATAAGGGG + Intronic
1041810571 8:61904161-61904183 ATAACTAGTTCTCAAATAAGAGG + Intergenic
1043546605 8:81322521-81322543 ATAACTTGTGCTCAAGTAAGAGG + Intergenic
1043814336 8:84783453-84783475 ACAAGTAGTCCTCAAGTAAGAGG + Intronic
1044249862 8:89993276-89993298 ATAATTAGTCCTCAAGTAAGAGG + Intronic
1044322435 8:90819414-90819436 ATAAATAGGCCTCTAGTATGAGG + Intronic
1044585703 8:93867505-93867527 GCAACTAGTCCTCAAGTAAGAGG - Intronic
1045543431 8:103107169-103107191 ATAACTAGTTGTCAAGTAAGAGG - Intergenic
1046258477 8:111733058-111733080 ACAACTAGTCCTCAAATAAGAGG - Intergenic
1046274257 8:111936903-111936925 ATAACCAGGCCTTTAGTAAGAGG + Intergenic
1047802570 8:128325289-128325311 TTAAGTAGGCTTCAAATAAGTGG - Intergenic
1047940021 8:129820704-129820726 ATAACTAGTTCCCAAGTATGAGG + Intergenic
1048850406 8:138640000-138640022 ATAACTAGTCCTCAAGTGAGAGG - Intronic
1050758369 9:9035671-9035693 ATAACTAGTCCTCAAGTAAGAGG - Intronic
1052079336 9:24184270-24184292 ACAACTAGAACTCAAGGAAGTGG - Intergenic
1052421760 9:28251476-28251498 ACAACTAATCCTCAAATAAGAGG - Intronic
1053558971 9:39169741-39169763 ACAGCTTGTCCTCAAGTAAGAGG - Intronic
1053823093 9:41989988-41990010 ACAACTTGTCCTCAAGTAAGAGG - Intronic
1054138140 9:61449202-61449224 ACAGCTTGTCCTCAAGTAAGAGG + Intergenic
1054607480 9:67197378-67197400 ACAACTTGTCCTCAAGTAAGAGG + Intergenic
1058281598 9:103123158-103123180 ATAACTAGTCCTCAGGTAACAGG + Intergenic
1058387031 9:104448682-104448704 ATAACTAGTCCTCATGTAAGAGG + Intergenic
1186230576 X:7449421-7449443 ATAACTAGTCCTCAAGTAAGAGG - Intergenic
1192593128 X:72378439-72378461 TTAACTTGGCCTCTGGTAAGGGG - Intronic
1192923117 X:75728892-75728914 AGAAATAGGCCAAAAGTAAGGGG + Intergenic
1193008283 X:76645392-76645414 ATAACAAGTCTTCAAGTAAGAGG - Intergenic
1195907931 X:109863880-109863902 ATAACTAGGCATCAAGTGTGAGG - Intergenic
1201768196 Y:17592728-17592750 ATAAGGAGGCCTCAGGTAAAGGG - Intergenic
1201833357 Y:18313257-18313279 ATAAGGAGGCCTCAGGTAAAGGG + Intergenic
1202581183 Y:26382095-26382117 ATAACTAGGAAGCAAGGAAGAGG - Intergenic