ID: 915684063

View in Genome Browser
Species Human (GRCh38)
Location 1:157613464-157613486
Sequence TCAGTAACACAGATAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915684060_915684063 6 Left 915684060 1:157613435-157613457 CCATAAGAAAGAATGAAACCTTG No data
Right 915684063 1:157613464-157613486 TCAGTAACACAGATAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915684063 Original CRISPR TCAGTAACACAGATAGAGCT GGG Intergenic
No off target data available for this crispr