ID: 915703276

View in Genome Browser
Species Human (GRCh38)
Location 1:157818503-157818525
Sequence TAGTGGGGAAGGAGGAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 915
Summary {0: 1, 1: 1, 2: 7, 3: 66, 4: 840}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915703276 Original CRISPR TAGTGGGGAAGGAGGAATGA GGG Intronic
900010095 1:98851-98873 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
900026206 1:275435-275457 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
900035990 1:409288-409310 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
900057614 1:645039-645061 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
900384085 1:2401406-2401428 GAGAGAGGAAGGAGGAAGGAGGG - Intronic
900525084 1:3124652-3124674 TGGAGCGGAAGGAAGAATGAGGG + Intronic
901309749 1:8260051-8260073 AAGAAGGGAAGGAGGAAGGAAGG - Intergenic
901352713 1:8611912-8611934 TGGTGGGGAGGGAGTAGTGAGGG - Intronic
901690278 1:10968681-10968703 AGGTGGGGATGGAGAAATGACGG - Intronic
901938619 1:12645128-12645150 AAGGAGGGAAGGAGGAAGGAAGG - Intronic
902464412 1:16607166-16607188 AAGGAGGGAAGGAGGAAGGAAGG + Intronic
902650881 1:17836827-17836849 TTGTGGGGAGGGAGGATTCAGGG + Intergenic
902676622 1:18013185-18013207 GAGTGGGGGAGGAGGAAAGCTGG - Intergenic
902850617 1:19153256-19153278 TTGTGGGGGAGTAGGAATGGTGG - Intronic
903115032 1:21172292-21172314 GTCTGGGGAAGGAGGAATTAAGG - Intronic
903396173 1:23003409-23003431 TAAGGGAGAAGGAGGAATGGAGG + Intergenic
904087176 1:27917072-27917094 GAGGGAGGAAGGAGGAAGGAAGG - Intergenic
904393818 1:30204659-30204681 TAAGGGAGAAGGAGGAATGCAGG - Intergenic
904918090 1:33984825-33984847 AAGGAGGGAAGGAGGAAGGAAGG + Intronic
905774124 1:40657291-40657313 CAGTGGGGAAAGAGGCAGGATGG + Intronic
906166253 1:43688649-43688671 TCGTGGGGCAGGAGGAAGAATGG + Intronic
906642915 1:47452264-47452286 TGGTGGGGAAGGGGGAGTGGGGG + Intergenic
906661981 1:47589546-47589568 CGGTGAGGAAGGAGGGATGATGG - Intergenic
907338919 1:53719636-53719658 AACTGGGGCAGGAGGAAGGAGGG + Intronic
907623019 1:56001302-56001324 AAGTGGGTAAGAAGGAAGGAAGG + Intergenic
908441662 1:64161368-64161390 AAGTTGGGAAGGAGGAGGGAGGG + Intronic
908554147 1:65240274-65240296 TAGAGGGCAAGGAAGAAAGAGGG - Intergenic
908697658 1:66862767-66862789 TAGTGGGAAGGGAGGTGTGATGG - Intronic
908725172 1:67167963-67167985 TAGGGAGGAAGAAGGAAAGAAGG - Intronic
908732354 1:67239026-67239048 GAGTGAGGAAGGAGGATGGAAGG + Intronic
909296386 1:73954377-73954399 AAGGGAGGAAGGAGGAAGGAAGG - Intergenic
909345352 1:74578712-74578734 TATCGGGGGAGGAGGAAGGAAGG - Intronic
909465509 1:75969581-75969603 CAGTGGGGCAGAGGGAATGATGG + Intergenic
909837134 1:80270433-80270455 TAATGGGAAAGGAGGCAAGAGGG - Intergenic
910049235 1:82956594-82956616 TAAGGGAGAAGGAGGAATGGAGG - Intergenic
910479883 1:87646925-87646947 TTGTGGGGAAAGAGGAAAGGAGG + Intergenic
910500089 1:87880354-87880376 AAGGAAGGAAGGAGGAATGAAGG - Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912730008 1:112093797-112093819 GAGGGAGGAAGGAGGAAGGAAGG + Intergenic
912997645 1:114547273-114547295 GAGTGGGGAAAGAGGGCTGAGGG + Intergenic
913963603 1:143357092-143357114 AAGAGAGGAAGGAAGAATGAAGG - Intergenic
914057963 1:144182681-144182703 AAGAGAGGAAGGAAGAATGAAGG - Intergenic
914121183 1:144783684-144783706 AAGAGAGGAAGGAAGAATGAAGG + Intergenic
914755995 1:150561913-150561935 GAGTGGGGAAGGAGGCAAAAGGG + Intergenic
914863562 1:151406391-151406413 TAGTGGGGAAGGAAGGAGGAGGG + Exonic
914920613 1:151844838-151844860 TAGTGGGGAAAGAGGTCTGGAGG - Intergenic
915524246 1:156466496-156466518 GAGGGGCCAAGGAGGAATGAGGG + Exonic
915703276 1:157818503-157818525 TAGTGGGGAAGGAGGAATGAGGG + Intronic
916046677 1:161005278-161005300 GGGAGGGGAAGGAGGAAGGAGGG - Intronic
916170925 1:162001087-162001109 TATGGGGGAAGGAGGTATAATGG - Intronic
916203516 1:162294146-162294168 GAGAGGGGAAGAAGGAAGGAAGG + Intronic
916238596 1:162615408-162615430 TGGTGGGGTAGGAAGAATAATGG - Intergenic
916287187 1:163121099-163121121 TACTGGGGTAGGAGGGAAGAAGG + Intronic
916437469 1:164790498-164790520 TAGCTGGGAAGGAGAAAAGAAGG - Intronic
916784500 1:168075991-168076013 TACCGTGGAAGGAGAAATGAAGG - Intergenic
916863747 1:168833999-168834021 TGGTGGGGTAGGAAGAGTGAAGG - Intergenic
916959915 1:169878937-169878959 TAGTGGGTAGGGAGGAAGGTAGG - Intronic
917762199 1:178173947-178173969 TAGTGGGGAGGGGGGAATTAAGG - Intronic
917946216 1:179973972-179973994 TGGTGAAGAAGGAGGTATGATGG - Intronic
918576197 1:186063405-186063427 GAGTGGGGAGGGAGAAAGGAAGG + Intronic
919148550 1:193665565-193665587 TAATGGGGAAGGAAGAAAAAAGG - Intergenic
919460133 1:197867066-197867088 AAGTAAGGAAGGAGGAAGGAAGG + Intergenic
919990075 1:202703414-202703436 AAGTGGGGAGGGAGAGATGAAGG + Intronic
920547987 1:206834602-206834624 GAGTGGGAAAGAAGGAGTGAAGG + Intronic
922068899 1:222171078-222171100 TAGTGTGGAAGGGGCCATGAAGG - Intergenic
922435192 1:225598320-225598342 AAGTGAGAAAGAAGGAATGAAGG + Intronic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
922968074 1:229709278-229709300 CAGTGGGGAAGGAGAAAACATGG - Intergenic
923044091 1:230342413-230342435 TAGTGTGCAAGGAGCTATGAAGG + Intronic
923241644 1:232090796-232090818 TGGAGGGGAAGGAGGAACGTGGG - Intergenic
923398928 1:233596383-233596405 TTGTGGGGAGGGTGGAATGCAGG + Intergenic
923433906 1:233950480-233950502 AAGTGGGGAGGGAGAAAGGAAGG - Intronic
923751824 1:236753830-236753852 GAGTGGAGAAGGAGAAACGAAGG - Intronic
924239981 1:242031315-242031337 TGGGGGAGGAGGAGGAATGAGGG + Intergenic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924576332 1:245284034-245284056 GAGAGGGAAAGGAGGGATGAGGG - Intronic
1063157240 10:3391013-3391035 ATGTGGGGATGGAGGAATGGGGG + Intergenic
1063501815 10:6562136-6562158 TCGTGGGTAAGGAAGAACGAAGG + Intronic
1063830566 10:9947563-9947585 AAATGGGAAAGGAGGAATGCAGG + Intergenic
1064151267 10:12867191-12867213 TACAGAGGAAGGAGGAATGGAGG + Intergenic
1064350142 10:14568714-14568736 TACTGGGGAAGGAGGCAGCATGG + Intronic
1064868832 10:19914072-19914094 GAGAAGGGAAGGAGGAAAGAAGG + Intronic
1065081424 10:22133489-22133511 CAGAAGAGAAGGAGGAATGATGG - Intergenic
1065091745 10:22242334-22242356 TAATGGGGAATGGGGAATGAGGG + Intergenic
1065232780 10:23615599-23615621 GAGTGGGGAGGGTGGAAGGAGGG - Intergenic
1065302186 10:24332893-24332915 TAGGAGGGAAGGAGGAATTTAGG + Intronic
1065383940 10:25115401-25115423 AAGGGGGGAGGGAGGAAGGAAGG - Intergenic
1065438589 10:25726554-25726576 AAGTGGGGAGAGAGGAAAGAAGG - Intergenic
1065494992 10:26318593-26318615 CAGGGAGGAAGGAGGAAGGAAGG + Intergenic
1067300689 10:45006060-45006082 GTGTGTGGAAGGAGGAAAGAGGG + Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1068498342 10:57813951-57813973 GAGTGGGGAAGGTGGAAGGTGGG - Intergenic
1068689797 10:59904389-59904411 TGTTTGGGAGGGAGGAATGAGGG - Intronic
1069285132 10:66704564-66704586 TAGTGGGGGTGGAGGAATCTGGG + Intronic
1069679374 10:70273189-70273211 TGGTAGGGAAGGATGGATGATGG + Intronic
1069770149 10:70893482-70893504 GAGTGGGGAAGGATGAGGGAAGG + Intergenic
1069845072 10:71365347-71365369 TATTGGGGAAGGAGTAGTGGGGG + Intergenic
1070537748 10:77392200-77392222 CAGTGGGGAGGAAGGAAGGAAGG + Intronic
1070729229 10:78813845-78813867 GAATGGGGCAGGAGGAAGGAGGG - Intergenic
1071718477 10:88120093-88120115 GAGGGGGGAAGCAGGAACGAGGG + Intergenic
1072182746 10:93003284-93003306 TAGTGGGGGAGGTGGAAAGGTGG + Intronic
1072975523 10:100054205-100054227 TGGGGGGGATGGAGGAAAGAAGG - Intronic
1072977753 10:100074101-100074123 TACTGGGCAAGGAGGAATTAAGG - Intronic
1073341534 10:102748454-102748476 TATTGTATAAGGAGGAATGATGG - Intronic
1073834212 10:107422248-107422270 AAGAGGGGAAGGATAAATGAAGG + Intergenic
1074932350 10:118141528-118141550 AAGTATGGAAGGAGGAGTGAAGG - Intergenic
1074963128 10:118465619-118465641 AAGGAGGGAAGGAGGAAGGAAGG + Intergenic
1075412768 10:122241203-122241225 TGGTGTGGAAGGAGGTAAGATGG + Intronic
1075713223 10:124541852-124541874 CAGTGGGGAAGTAGGGGTGAAGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077992699 11:7426141-7426163 TAGCTGGGAGGGAGGAAGGAAGG - Intronic
1078666760 11:13332133-13332155 AGGTGGGGAGGGAGGAATCAGGG + Intronic
1078720730 11:13881045-13881067 TAATGGGGCAGGTGGAATGGAGG + Intergenic
1079253102 11:18802102-18802124 AAGAGGGGAAGAAGGAAGGAAGG - Intergenic
1079370149 11:19845683-19845705 TAGTGGGTTAGGAAGAGTGAAGG - Intronic
1080032031 11:27671796-27671818 GGGTGGGGTAGGTGGAATGAGGG - Intronic
1080270562 11:30446983-30447005 TAGCAGGGAAGGAGGGATGGAGG + Intronic
1080337778 11:31218776-31218798 GAGTGAGGGAGGAAGAATGAAGG - Intronic
1080708139 11:34718808-34718830 GACAGGGTAAGGAGGAATGAAGG + Intergenic
1081806768 11:45895141-45895163 AAGTGGGGCGGGAGGGATGATGG + Intronic
1082030356 11:47599115-47599137 AAGTGGAGATGGAGGAGTGAGGG + Intergenic
1082063178 11:47877776-47877798 TTGTGGAGAAAGAGGAAGGAAGG - Intergenic
1082757399 11:57091745-57091767 TGGTGAGGAAGGAGGAAGGATGG - Intergenic
1082988708 11:59189084-59189106 TAATGGGGAAAGAGGAATTTGGG + Intronic
1083035933 11:59637433-59637455 AAGTGGGGAAGAAGGAAGCATGG + Exonic
1083534202 11:63453740-63453762 TAAGGGAGAAGGAGGAATGGAGG - Intergenic
1083741984 11:64716080-64716102 TAGCAGGGAAGGAGGAAGGGAGG - Intronic
1083913027 11:65720976-65720998 GAGAGGGGAGGGAGGAAAGAGGG - Intergenic
1084215891 11:67646693-67646715 CAGAGGGGAAGCAGGAGTGAAGG + Intronic
1084685496 11:70692158-70692180 TAATGGCGGAGGAAGAATGAGGG + Intronic
1085369654 11:75988904-75988926 AAGTGGGGAAGGGGGATGGATGG + Intronic
1085378943 11:76094989-76095011 GAGTTGGGAAAGAGGACTGAAGG + Intronic
1085442458 11:76577269-76577291 TACTGGGGCAGGAAGGATGAGGG - Intergenic
1086291777 11:85318641-85318663 TATTAGAGAAGGAGGAATTAGGG + Intronic
1086550057 11:88044421-88044443 TAAGGGAGAAGGAGGAATGGAGG - Intergenic
1086605182 11:88687083-88687105 TGGTGGGGTAGGATGAAGGAAGG - Intronic
1088158797 11:106842717-106842739 AAGGGGGTAGGGAGGAATGAAGG + Intronic
1088463932 11:110112938-110112960 CAGTGGGGCAGGAGAGATGACGG - Intronic
1088519095 11:110675494-110675516 TTGTGGAGGAGGAGGAAGGATGG + Intronic
1089307546 11:117536121-117536143 GAGAGGGGAAGGAGAAATCAGGG + Intronic
1089867202 11:121642392-121642414 TAAGGGAGAAGGAGGAATGGAGG + Intergenic
1090531082 11:127592026-127592048 AAGAAGGGAAGGAGGAAGGAAGG + Intergenic
1090768334 11:129896020-129896042 GGGACGGGAAGGAGGAATGAAGG - Intergenic
1091183102 11:133625265-133625287 CAGTGAGGAAGGAGCACTGATGG + Intergenic
1091447200 12:550892-550914 CAGTGGAGGAGGAGGAGTGAGGG - Intronic
1091597325 12:1886831-1886853 TAGAGGGAAGGGAGGAATGCTGG + Intronic
1091707702 12:2710302-2710324 TAGTGGGGAAGCAGAAAAGTTGG - Intergenic
1092230314 12:6772475-6772497 AAGTGGGGAAGGTGGAGGGAAGG + Intergenic
1092308131 12:7322735-7322757 TAAGGGGGAGGCAGGAATGATGG - Intronic
1093709536 12:22314205-22314227 TAGTGAGCATGGAGGAAGGAGGG - Intronic
1093812992 12:23510483-23510505 TAAGGGAGAAGGAGGAATGGAGG + Intergenic
1094825621 12:34266914-34266936 TAAGGGAGAAGGAGGAATGGAGG - Intergenic
1095536238 12:43251397-43251419 TAGAGTGGAAGGAGAGATGATGG - Intergenic
1095942269 12:47735046-47735068 TGGAGGGGAAGGAGGAAAGGAGG + Intronic
1096229818 12:49890626-49890648 GAGTGGGGATGGAGGAAGAAGGG - Intronic
1097638337 12:62148542-62148564 AAGAGGGGAAGGAGGAAGGAGGG + Intronic
1098134220 12:67384785-67384807 TAGTCAGGGAGCAGGAATGATGG - Intergenic
1098177280 12:67805954-67805976 TGGTGGGGAAGGAGGGAGGGAGG - Intergenic
1098725095 12:73954424-73954446 TAGTGGGAAAGGAGGCATTCAGG - Intergenic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1098781299 12:74690174-74690196 TTGTGGGCAAGGATGAAGGAGGG - Intergenic
1098890849 12:76009158-76009180 CAGTGGGGTAGGAAAAATGAAGG - Intergenic
1099055309 12:77833103-77833125 GAATTGGGAAGGAGGAATGGTGG - Intronic
1099224179 12:79949414-79949436 TAGAGAGGAAGGAGGACAGAGGG - Intergenic
1099482226 12:83181940-83181962 TAGTGGGGAAGTCTGTATGAGGG - Intergenic
1099761396 12:86924325-86924347 CAGTGGGGAAGAAAGAATTAGGG + Intergenic
1099941491 12:89194525-89194547 TGTTGGGGAAGGAGGGAGGAAGG - Intergenic
1099941604 12:89195630-89195652 TTGTGGGGGAGGAGGAAGGGAGG - Intergenic
1100281187 12:93119917-93119939 GACTGGGGAAAGAGGAATCATGG + Intergenic
1100672313 12:96829869-96829891 TGGTGGGGGAGGAGGAATTGAGG - Intronic
1101684045 12:106999550-106999572 TAGTTGGGAAGAAGGAATGAAGG - Exonic
1102662471 12:114541667-114541689 CAGTGGGGATTTAGGAATGAGGG + Intergenic
1102665269 12:114566634-114566656 CAGTGGGGATTTAGGAATGAGGG - Intergenic
1102729836 12:115098741-115098763 AAATGGGGAAGAAGGAAAGAAGG - Intergenic
1102904376 12:116662874-116662896 AAGAGGGGGAGGAGGAAGGACGG - Intergenic
1103486719 12:121288129-121288151 CAGTGGGGGAAGAGGAAGGAAGG - Intronic
1104004620 12:124883240-124883262 GAGGGAGGAAGGAGGAAGGAAGG + Intergenic
1104190636 12:126479256-126479278 TGGTGGGGTAGGATGAAGGAGGG + Intergenic
1104191078 12:126482445-126482467 AAGTGGGGAAGGAGGGAGGGAGG - Intergenic
1104368510 12:128199966-128199988 CAGAGAGGAAGGAGGAAAGAAGG - Intergenic
1104676011 12:130713037-130713059 GAGAGGGAGAGGAGGAATGAGGG + Intronic
1104841002 12:131825651-131825673 AAGAGGGGAGGGAGGAAGGAAGG - Intergenic
1104849218 12:131863293-131863315 AAGTGGGGAGGGAGGGGTGAAGG + Intergenic
1105702492 13:22943833-22943855 TAGTGGTGAAGGGGGAATGGGGG - Intergenic
1106044890 13:26129731-26129753 GAGTTGGGAGGGAAGAATGAAGG - Intergenic
1106148718 13:27076593-27076615 TAGTGGGGAAATAAAAATGAAGG - Intronic
1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG + Intergenic
1106464363 13:29999639-29999661 TATTGGGAAAGGAGGAGGGAAGG - Intergenic
1106478777 13:30120784-30120806 TGGTGGGGATGTAGGAATGTTGG + Intergenic
1106590917 13:31097923-31097945 TAGTGTGGGAGGAGAAATCACGG - Intergenic
1106766755 13:32921111-32921133 TAGTGGGAAATGAGGAAACATGG - Intergenic
1107153302 13:37137765-37137787 TGGAGGGTGAGGAGGAATGAAGG - Intergenic
1107579215 13:41764294-41764316 TGGAAGGGAAAGAGGAATGAAGG - Intronic
1107599797 13:42001881-42001903 GATTCAGGAAGGAGGAATGACGG - Intergenic
1107804980 13:44145267-44145289 TAGTGGGAAAGGAGTGAGGATGG + Intronic
1108048393 13:46404894-46404916 GAGGGGGGAGGGAGGAAGGAAGG + Intronic
1108208807 13:48117832-48117854 TATGGGGGAGTGAGGAATGAAGG + Intergenic
1108326537 13:49337990-49338012 TATTGGAGAAGGAGGTGTGAGGG - Intronic
1109180890 13:59212832-59212854 TAGAGGGGAAGAAAGAAGGAAGG + Intergenic
1109184846 13:59255702-59255724 AAGTGGGGAGTGAGGAAAGAAGG + Intergenic
1109400421 13:61820354-61820376 TAGAGGGGAAGGGGGAAGGAGGG + Intergenic
1110268456 13:73566538-73566560 CAGTGTGGAAGGTGGAATAATGG + Intergenic
1110586421 13:77199024-77199046 TAGGGGGGGAGGAGGCAAGATGG + Intronic
1110967411 13:81716925-81716947 AAGAGGGTGAGGAGGAATGAAGG - Intergenic
1111708149 13:91777102-91777124 TGGTGGGGGAGGAGGAAGAAAGG - Intronic
1111766590 13:92538395-92538417 AGGTAGGGAAGAAGGAATGAAGG - Intronic
1111882044 13:93969710-93969732 TAGAGGGGAGGGAGGGATGAAGG - Intronic
1111994439 13:95150486-95150508 CAGTGGGGAAGGGGGAGGGAGGG - Intronic
1112381751 13:98897419-98897441 TAGTGGGGAGGGAGGAACAGGGG - Intronic
1112508748 13:99990748-99990770 TCGTGGGGCAGGAGGGATGCTGG - Intergenic
1112763399 13:102715403-102715425 TGGTGGGGAAGGAGAATGGAGGG + Intergenic
1112889465 13:104212505-104212527 TAAGGGAGAAGGAGGAATGGGGG + Intergenic
1113043037 13:106125273-106125295 TGGAGGGGAAGGAGGAAGAAGGG - Intergenic
1113193576 13:107778756-107778778 GAGTGGGGAGGGAAGAAAGAGGG - Intronic
1113585109 13:111459582-111459604 TAGAGGGAAAGGAGGAGTGGAGG + Intergenic
1113731030 13:112641694-112641716 TGGTGTGGAAGCAGGAATGACGG - Intergenic
1114040426 14:18673247-18673269 AAGGAGGGAAGGAGGAAGGAAGG + Intergenic
1114045464 14:18871764-18871786 AAGGAGGGAAGGAGGAAGGAAGG + Intergenic
1114118748 14:19647704-19647726 AAGGAGGGAAGGAGGAAGGAAGG - Intergenic
1114389242 14:22288784-22288806 TAGTAGGGAATGGGGAATAAGGG - Intergenic
1114623152 14:24111087-24111109 TACTTGGGAAGGATGAAGGAGGG - Intronic
1114647591 14:24264187-24264209 TAGTGGGAAGGAAGGAAAGAAGG - Intronic
1114662211 14:24354248-24354270 GAGGAGGGAAGGAGGAAGGAAGG - Intergenic
1114755677 14:25256833-25256855 TAATGGGGAAGGAAGAATCCAGG - Intergenic
1115147219 14:30239566-30239588 TAGGGGGAAAGGAGGAAGGAGGG - Intergenic
1115307968 14:31951621-31951643 TGGAGGGGAAGGAGGCATGGGGG - Intergenic
1115310474 14:31974066-31974088 GAGTGGGGCAGCAGGACTGAAGG - Intergenic
1115495762 14:34002979-34003001 GAGTGGGGAAGAAGGAAGCAAGG + Intronic
1115814849 14:37152975-37152997 AAGTGGGGAAGGAGGAAAAGAGG + Intronic
1115834026 14:37377274-37377296 CAGTAGGGGAGGAGGAAAGAGGG + Intronic
1115967080 14:38902639-38902661 TAGTGGGGAAGTAGGACAAATGG - Intergenic
1116218933 14:42056762-42056784 AGGAAGGGAAGGAGGAATGAAGG + Intergenic
1116465780 14:45230993-45231015 TAGTGAAGAAGCAGGAATGTGGG + Intronic
1116890654 14:50264727-50264749 AAGTGGGGAGGGAGGGAGGAAGG + Intronic
1117836464 14:59811949-59811971 TAGTTAGGAAGGAGGAAAGGAGG + Intronic
1117971453 14:61254900-61254922 AGCTGGTGAAGGAGGAATGAAGG - Intronic
1118905491 14:70020481-70020503 TAGCTGGGAAGGAGGAAGGAAGG + Intronic
1119182417 14:72613966-72613988 GAGTGGGGCAGGGGGAAGGAGGG - Intergenic
1119618620 14:76114914-76114936 TTGTGGGGAAGGACGAAGGAGGG + Intergenic
1119635476 14:76269848-76269870 TTGTGGAGAGGGAGGAAGGAGGG - Intergenic
1119817552 14:77583553-77583575 TGGTGGAGATGGGGGAATGAGGG - Intronic
1120275097 14:82363080-82363102 TAGTGGGGGAGAAGTAAAGAAGG - Intergenic
1120862316 14:89265955-89265977 TGGTGGTGAAGGAGGAGTGCAGG + Intronic
1121007183 14:90498001-90498023 GAGTGGGGAAGAGGGAAAGAGGG + Intergenic
1121036223 14:90705818-90705840 TAGTGGGGAAGGTGTAAAGTAGG - Intronic
1122240188 14:100359494-100359516 CAGTGGGGAGGGAGAAATGGGGG + Intronic
1122329870 14:100904819-100904841 AAGTGGGGAACGAGAGATGAGGG + Intergenic
1122970451 14:105150082-105150104 TGGTGGGGAAGGGGGAAGGCAGG + Intronic
1123051323 14:105545550-105545572 GAGTTGGGAGGGAGGAATGGGGG - Intergenic
1123634745 15:22293021-22293043 TGGTGGGGAGGGAGTAGTGAGGG + Intergenic
1123882630 15:24689987-24690009 TAAGGGAGAAGGAGGAATGGAGG + Intergenic
1123910600 15:24963079-24963101 TAGTGGGGAGAGAGGAAGGGAGG + Intronic
1124597905 15:31106101-31106123 TTGTGGGGAAAGAAGAATGAGGG - Intronic
1124856132 15:33391129-33391151 TGGTGGGGCTGGAGGGATGAGGG - Intronic
1125108506 15:36003007-36003029 TAGTGGAGAATGGGGAAGGAGGG + Intergenic
1125499661 15:40231567-40231589 TTGTTGGGAAGGAGAAAGGAAGG + Intergenic
1125762740 15:42108390-42108412 GAGTGGGGAAAGAGGTCTGAAGG - Intergenic
1126227053 15:46282868-46282890 TGATGGGGAAGGAGGAATGGAGG + Intergenic
1126353337 15:47768154-47768176 TACTGGGGAAGAAGCTATGATGG - Intronic
1126493563 15:49265706-49265728 TACTGGGGCAGGAGCAAAGATGG - Intronic
1126852210 15:52804380-52804402 TCGGGGGGAGGGAGGAATTAGGG - Intergenic
1127137557 15:55940491-55940513 GAGGAGGGAAGGAGGAAGGAGGG - Intronic
1127157258 15:56140610-56140632 TAGCGGGGAAGGAGCCAAGATGG - Intronic
1127180722 15:56414385-56414407 AAGTGGGGAAGGTGGAAAAAGGG - Intronic
1127272382 15:57413254-57413276 AAGGAGGGAAGGAGGAATGGAGG - Intronic
1127414162 15:58740812-58740834 TTGTGTTGAAGGAGGAATTACGG + Intronic
1127959796 15:63882314-63882336 TACTGGGTAAGGAGAAAGGAGGG + Intergenic
1128307392 15:66608537-66608559 GAGTGGGGAGGGAGGAGGGAAGG + Intronic
1128538824 15:68510900-68510922 GTGATGGGAAGGAGGAATGAGGG - Intergenic
1129832792 15:78681664-78681686 TAGAGGGGAGGGAGAGATGAGGG + Intronic
1129921535 15:79323202-79323224 TAATGGGCAAGGAGGACTAAGGG - Intronic
1129933124 15:79428496-79428518 AAGGAGGGAAGGAGGAAGGAGGG - Intergenic
1129944075 15:79524204-79524226 GAGTGGGAAGGGAGGAGTGATGG - Intergenic
1130088096 15:80795395-80795417 CAGTGGGGAAGGAGAAGTGTGGG + Intronic
1130148212 15:81291730-81291752 TAATGGGGAGGGAGGGAGGAAGG + Intronic
1130151202 15:81313070-81313092 GAGTGGGGCAGGAGGCAGGAAGG + Exonic
1130202627 15:81846283-81846305 TAGGGGAGAAGGTGGAATCACGG + Intergenic
1130924569 15:88375398-88375420 TAGTGGGGGAGGAGGCAGAATGG - Intergenic
1130962512 15:88672059-88672081 GAGTGGGGAGGAAGGAAAGATGG + Intergenic
1131079600 15:89523535-89523557 TATTGGGGACAGAGGAGTGAAGG - Intergenic
1131248016 15:90812735-90812757 GAGTGGGGAAAGAGAAAGGAAGG + Intronic
1131283251 15:91038010-91038032 TAGAGGGGAAGGAGGGAGGGAGG + Intergenic
1131397488 15:92098088-92098110 TTGTGGGGAAGGAGCAAGGCAGG + Intronic
1131486437 15:92824747-92824769 TCGTGGGGGAGGAGGAAGGAAGG + Intergenic
1131744706 15:95434797-95434819 AAGGAGGGAAGGAGGAAGGAAGG - Intergenic
1131789019 15:95944323-95944345 TAGTGGGGGAGGAGGAATCAGGG - Intergenic
1131860619 15:96649598-96649620 TAGCTGGGGAGGAGGGATGATGG - Intergenic
1132057276 15:98661901-98661923 TTGTGGGGAAGGAGGACTGGAGG - Intronic
1132070422 15:98771881-98771903 CAGTGGAGAAGAAGGAAGGAGGG - Intronic
1133033572 16:3022819-3022841 TTGTGGGGAAGAAGGAAGGTGGG + Exonic
1133514556 16:6495804-6495826 TAGGTGGGAAGAAGGAGTGAGGG - Intronic
1133748592 16:8706887-8706909 TTTTGGCTAAGGAGGAATGAGGG + Intronic
1133938026 16:10284401-10284423 TAAGGGAGAAGGAGGAATGGAGG - Intergenic
1134107478 16:11494432-11494454 AAGTGGGGAAGGGGGAATGAGGG + Intronic
1134275486 16:12772162-12772184 TAGTGAGGAAGGAGTGTTGATGG + Intronic
1135024642 16:18989625-18989647 TAGTGGCGAAGGAGGCAGGTAGG + Intronic
1135297852 16:21298992-21299014 TGGTGGAGTAGGAGGAAAGAGGG - Intronic
1135315431 16:21440932-21440954 TAGTGGCGAAGGAGGCAGGTAGG - Intronic
1135368357 16:21873200-21873222 TAGTGGCGAAGGAGGCAGGTAGG - Intronic
1135443460 16:22497949-22497971 TAGTGGCGAAGGAGGCAGGTAGG + Intronic
1135449259 16:22543414-22543436 TAGTGGCGAAGGAGGCAGGTAGG + Intergenic
1135778644 16:25279352-25279374 TAGTGGGGAGGAAGAGATGAGGG + Intergenic
1135938780 16:26803172-26803194 TAGTGAGAAAGGAAGAAGGAAGG + Intergenic
1136312101 16:29419591-29419613 TAGTGGCGAAGGAGGCAGGTAGG - Intergenic
1136325540 16:29521388-29521410 TAGTGGCGAAGGAGGCAGGTAGG - Intergenic
1136367174 16:29814193-29814215 AAGGGAGGAAGGAGGAGTGAAGG - Intronic
1136368419 16:29820643-29820665 GAGTGGGGAAGGAGGATGGGTGG + Intronic
1136440229 16:30261370-30261392 TAGTGGCGAAGGAGGCAGGTAGG - Intergenic
1136605511 16:31331021-31331043 AGGTGGGGGAGGAGGACTGAGGG + Intronic
1137473848 16:48789545-48789567 TAGAGGGGAAAGATGAATGCTGG + Intergenic
1137741545 16:50780889-50780911 TGGTGGGGAGGCAAGAATGAGGG + Intronic
1138277021 16:55742629-55742651 AAGTGGGAAAGGTGGAAAGATGG - Intergenic
1138282917 16:55785806-55785828 AAGTGGGAAAGGTGGAAAGATGG - Intergenic
1138286015 16:55810792-55810814 AAGTGGGAAAGGTGGAAAGATGG + Intronic
1138544386 16:57706989-57707011 GAGTGGGGAAAGAGGATTGGAGG - Intronic
1138696743 16:58820932-58820954 TACTAGGGAAGCAGGAATAAGGG + Intergenic
1139139689 16:64246202-64246224 AAGTGTGGAGGGAGGAAGGAGGG + Intergenic
1139511981 16:67432729-67432751 TAGGGGGGAAGGAGGCACAAGGG + Intronic
1139657833 16:68399643-68399665 TGGGGAGGAAGGAAGAATGATGG + Intronic
1139886726 16:70213652-70213674 TAGTGGTGAAGGAGGTAGGTAGG - Intergenic
1140194115 16:72843068-72843090 GATCTGGGAAGGAGGAATGAAGG + Intronic
1141285788 16:82670356-82670378 CAGTGGGGAAGGTGGAGAGAAGG - Intronic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141642981 16:85352309-85352331 TAATGGGGAAGGATGAAAGGGGG - Intergenic
1142223562 16:88866609-88866631 TAGAGGGGCAGGAGGAAGGTGGG + Exonic
1142571914 17:880219-880241 TCCTGGGGACGGAGGAATGAGGG + Intronic
1142836879 17:2593910-2593932 GAGAGGGGAGGGAGGAAGGAGGG - Exonic
1142932254 17:3296822-3296844 TGGTGGGGATGGCGGAATGTTGG - Intergenic
1143157290 17:4846035-4846057 TCATGGGGAAGGAGGAAAAAGGG + Intronic
1143563649 17:7709135-7709157 AAGGGGTGAAGGAGGAAAGAGGG - Intronic
1144230608 17:13199526-13199548 AAGGAGGGAAGGAGGAAAGATGG - Intergenic
1144342529 17:14321743-14321765 GAATTGGGAACGAGGAATGAGGG + Intronic
1144346778 17:14356545-14356567 TAGGGGGTAAGGAGGCAGGAAGG + Intergenic
1145886820 17:28387832-28387854 AAATAGGGAAGAAGGAATGAGGG + Intronic
1145961126 17:28887037-28887059 TAGTGGGGAGGGAAGAAGGGAGG + Intronic
1146332235 17:31937123-31937145 GAGGGGGGAAGGAGGAGAGAGGG - Exonic
1146541462 17:33699353-33699375 TAGTGGGGAAGGAGACATGAGGG - Intronic
1146625205 17:34430144-34430166 GAGTGGGGTAGCAGGAATGGTGG + Intergenic
1146648609 17:34592198-34592220 AAGTGGGGAGGGAGGAAGGGTGG - Intronic
1146725546 17:35152854-35152876 GAGTGGGGAAGGAGGCAGGTGGG - Intronic
1147257892 17:39192896-39192918 AAGTGGGGAAAGAGGCATGAAGG + Intronic
1147354050 17:39877355-39877377 AATTGTGTAAGGAGGAATGAGGG - Intronic
1147360075 17:39924826-39924848 AAGTGGGGAGGGAGGAAGGGAGG + Intronic
1147759058 17:42785766-42785788 AAATGGGGAGGGAGGAAAGAAGG - Intronic
1148018650 17:44539632-44539654 AAGTGGGAAAGGAGGAGGGAAGG + Intergenic
1148041235 17:44708990-44709012 TTGAGGGGACCGAGGAATGAAGG + Intronic
1148156007 17:45425572-45425594 CAGTGGAGGAGAAGGAATGAGGG + Exonic
1148386096 17:47236290-47236312 CAGTTGGGAAGGTGGAATGAGGG + Intergenic
1148518387 17:48244286-48244308 TAGGGGCAAAGGAGGAAGGAAGG - Intronic
1148700096 17:49581962-49581984 TACTGGGGAAGGTGGAAAGGAGG - Intronic
1149027901 17:52051086-52051108 GAGTGGGAAGGGAGGAAGGAAGG + Intronic
1149992901 17:61392633-61392655 TACTAGGGAAGGAGGAAGGGAGG + Exonic
1150008651 17:61485753-61485775 CTTTGGGGAAGGAGCAATGAGGG - Intergenic
1150351076 17:64444935-64444957 TTATGGAGAAGGAGGAAAGATGG - Intergenic
1150665837 17:67136781-67136803 CAGGAGGGAAGGAGGAATGGGGG + Intronic
1151622338 17:75253827-75253849 TAAGGGAGAAGGAGGAATGGAGG - Intronic
1152338033 17:79708888-79708910 TACTGGGGAAAGAGAAAGGAAGG - Intergenic
1152541277 17:80977502-80977524 TGGGGGGAGAGGAGGAATGAGGG + Intergenic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1153221522 18:2866325-2866347 TAGAGGGGAAGGAGCCAAGATGG - Intronic
1153299805 18:3582829-3582851 GAGGGGGGAGGGAGGAAAGAAGG - Intronic
1153649412 18:7226533-7226555 TTGTGGGTAAGCAAGAATGAGGG - Intergenic
1153814641 18:8782033-8782055 TAGAGTGGAAGGAGGAAAGTTGG + Intronic
1155243952 18:23889663-23889685 GAGGGGGGAGGGAGGAAGGAAGG + Intronic
1155334226 18:24748672-24748694 GAGGAGGGAAGGAGGAAGGAAGG - Intergenic
1156292415 18:35759480-35759502 GAGAGGGGAAGGGGGAATGAAGG + Intergenic
1156302106 18:35845134-35845156 TAAGGGAGAAGGAGGAATGGAGG - Intergenic
1156375716 18:36513700-36513722 AAGAGGGGAAAGAGGGATGAAGG - Intronic
1156419725 18:36937752-36937774 TAGTGGGGAGGTGGGAATGAAGG - Intronic
1157158236 18:45288394-45288416 CAGTGGGGCAGGAGCAACGATGG + Intronic
1157293097 18:46423892-46423914 CAGTGAAGAAGGAGGAACGAGGG - Intronic
1157487817 18:48100938-48100960 TAGTGGGGAACGGGGAAGGCAGG + Intronic
1157619642 18:49008891-49008913 TCGTGGGGAAGGAGGGCTGGAGG + Intergenic
1158374815 18:56850920-56850942 CAGTGAGGAAGCAGGAATTAAGG - Intronic
1158493329 18:57929987-57930009 TCTTGTGGAAGGAGGTATGAAGG + Intergenic
1158514656 18:58120854-58120876 CAGTGGGGATGGGGGAGTGAGGG - Intronic
1158558732 18:58496260-58496282 TAGTGGGGAGGAAGGAACGAGGG - Intronic
1159046917 18:63377593-63377615 AAGGGGGGAAGGAGGAAGGAAGG - Intergenic
1159194208 18:65090837-65090859 GAGTGGGGAAGGAGAAGGGAGGG - Intergenic
1159847814 18:73486944-73486966 AAGGAGGGAAGGAGGAAGGAAGG - Intergenic
1160410184 18:78670649-78670671 GGGTGGGGAAGGAGGGATGGAGG - Intergenic
1160709553 19:544771-544793 AAGAATGGAAGGAGGAATGATGG - Intronic
1160709591 19:544896-544918 ATGGGAGGAAGGAGGAATGATGG - Intronic
1161708288 19:5832585-5832607 AAGTGGGGAGAGAGGAGTGAGGG + Intronic
1161813126 19:6481982-6482004 GAGCGGGGAAGGAGAGATGAGGG - Intronic
1161874564 19:6897953-6897975 GGGTGGGGAAGTAGGAAGGAAGG - Intronic
1162136059 19:8555901-8555923 AGATGGGGAAGGAGGAATGGAGG - Intronic
1162243796 19:9381803-9381825 AAGTGAGAAAGGAGGCATGAGGG - Exonic
1163066594 19:14801182-14801204 TATTAGGTAATGAGGAATGAGGG - Intronic
1163730194 19:18944552-18944574 TGGGGGGGAGGGAGGAAGGAAGG + Intergenic
1163900428 19:20095436-20095458 TAAAGGAGAAGGAGGAATGGAGG + Intronic
1164484704 19:28645003-28645025 TAGTGGGAAAAGAGGAAACAAGG + Intergenic
1164583911 19:29453539-29453561 AACTGGGGAAGGAAGAAAGATGG + Intergenic
1164741143 19:30576358-30576380 CAGTGGAGATGGAGGAACGATGG - Intronic
1164744103 19:30598952-30598974 AAGGAGGGAAGGAGGAAGGAAGG - Intronic
1164816073 19:31204399-31204421 AGGTAGGGAAGGAGGAATGGAGG - Intergenic
1165864053 19:38925338-38925360 CTGTGGGGAAGGAGGAAGAAGGG - Intronic
1165940059 19:39410422-39410444 AAGTGGGAGAGGAGTAATGAGGG - Intergenic
1166043250 19:40215405-40215427 TATTGGGGAAGGAGGGAGGGGGG + Exonic
1167046739 19:47054172-47054194 TAAGGGAGAAGGAGGAATGGAGG + Intergenic
1167277051 19:48545111-48545133 TCGTGGGGATGGAGTAATCAGGG + Intergenic
1168143917 19:54408585-54408607 GAGGGAGGAAGGAGGAAGGAAGG + Intergenic
1168507888 19:56951616-56951638 AGGTGGGGTAGGGGGAATGACGG + Intergenic
1202697446 1_KI270712v1_random:135349-135371 AAGAGAGGAAGGAAGAATGAAGG - Intergenic
925283988 2:2704173-2704195 AGGGAGGGAAGGAGGAATGAGGG - Intergenic
926152756 2:10434076-10434098 GAGTGGGGATGAATGAATGAAGG + Intergenic
926178351 2:10617145-10617167 TAGAGGGGAAGGGGAGATGATGG + Intronic
926504331 2:13692555-13692577 TGGTTGGGAATGAGGATTGAGGG - Intergenic
926612344 2:14958945-14958967 CAGTGGGAAAGGAGGAAGGGTGG + Intergenic
927813719 2:26195520-26195542 TATTGGGGAACGACGGATGAAGG + Intronic
927846831 2:26476479-26476501 GGGTGGGGAAGGGGGCATGACGG - Intronic
928529137 2:32172941-32172963 TAGGAGGGAAGGCGGAGTGATGG - Intronic
928857023 2:35814341-35814363 TAAGGGAGAAGGAGGAATGGAGG - Intergenic
928923794 2:36555280-36555302 TAGTGAGGACGGATGAAGGAAGG - Intronic
929261446 2:39870862-39870884 AAGTGGAGAAGGAGGAGTGGTGG + Intergenic
929625764 2:43405065-43405087 TAGAGGGGAAGGAGGAGGGTAGG - Intronic
930102302 2:47612888-47612910 TAGTGGGGAAGGAACACTCAAGG + Intergenic
930231034 2:48843976-48843998 CACTGGGGTAGGAGGAAGGATGG + Intergenic
930312251 2:49755951-49755973 AAGTGGGGAAGGGGGAAAGAAGG + Intergenic
930318595 2:49827307-49827329 CAGTGAGGAAGGATGAATCAAGG + Intergenic
931638577 2:64362101-64362123 TAGTGAGGAAGGAGGAACAGAGG + Intergenic
931867068 2:66425037-66425059 GAGCAGGGAAGGAGGAAGGATGG + Intergenic
932291755 2:70586775-70586797 TAAGGGGGAAGGAGGGATAAAGG - Intergenic
933154590 2:78959124-78959146 CAGTCTAGAAGGAGGAATGATGG + Intergenic
933209090 2:79545287-79545309 GAGTGGGGAAGGAGAAGTGAAGG - Intronic
933286437 2:80389410-80389432 TAGTGAGGAGGGAGGAAGGAAGG - Intronic
934970779 2:98762426-98762448 TACTGTGGAAGGAGGGATGAAGG - Intergenic
935524824 2:104152793-104152815 AAGTGGAGAAGGTGGTATGAAGG + Intergenic
935597243 2:104888801-104888823 TGGTGGTGAAGGAGAAAAGAGGG - Intergenic
935625592 2:105169832-105169854 TAGTGAGCAAGGGGGACTGATGG + Intergenic
935716997 2:105947989-105948011 GAGGGAGGAAGGAGGAAAGAAGG + Intergenic
935832130 2:107011285-107011307 TAGAAGGGAAGGAGGCAGGAAGG - Intergenic
936004078 2:108866411-108866433 TAGTGTGGTAGGCTGAATGATGG - Intronic
936055190 2:109257311-109257333 GAAGAGGGAAGGAGGAATGAAGG + Intronic
936504502 2:113094701-113094723 AAGGGTGGGAGGAGGAATGAGGG - Intergenic
937310859 2:120902516-120902538 AAGGAGGGAAGGGGGAATGAAGG + Intronic
939051738 2:137315516-137315538 TAGTGGGGGAGGAGCCAAGATGG - Intronic
940161780 2:150721361-150721383 TGGTGTGGAAGGAGGAATTATGG - Intergenic
940278232 2:151962001-151962023 GAGTGGGGAAGGATGAAGGGTGG - Intronic
940692571 2:156937504-156937526 GAGGGAGGAAGGAGGAAGGAAGG + Intergenic
940692913 2:156941769-156941791 GCTTGGGGAAGGAGGAATCAAGG + Intergenic
940767209 2:157802497-157802519 TAGTGGGGACTGAGGAACTATGG - Intronic
941409574 2:165137220-165137242 TAGTGGGGAAACTGGAATGGAGG - Intronic
941474882 2:165938741-165938763 AAGAGGGGAAGGAGAAAGGAAGG + Intronic
941481128 2:166014719-166014741 AAGAAGGGAAGGAGGAAAGAAGG + Intronic
942119436 2:172762277-172762299 TACTGGAGAGGGAGGAATGCTGG - Intronic
943499203 2:188666048-188666070 AAGGAGGGAAGGGGGAATGAGGG - Intergenic
943690635 2:190866219-190866241 AAGTTGGAAAGGAGGAATGTTGG + Intergenic
943736357 2:191359885-191359907 AAATGGGAAAGGAGGAAGGAAGG - Intronic
945473640 2:210256088-210256110 TAGAGGGGAAAGTGGAATTAAGG + Intergenic
945515301 2:210756643-210756665 TATTGGGGAAGGATGAGTGCAGG + Intergenic
946029150 2:216691385-216691407 TGGTGGGGAATGAGGTTTGATGG - Intronic
946353790 2:219172428-219172450 TGGTGGGGCAGAAGGACTGAAGG - Exonic
946388705 2:219402241-219402263 TGGTGGGGAAGGAGAGATCAGGG + Intergenic
946425470 2:219593215-219593237 TAGTAGGAAAGGGGGAAGGATGG - Intergenic
946809528 2:223508936-223508958 TTCTGGGGAAGGAGAAGTGATGG - Intergenic
947077717 2:226363919-226363941 AAGGAGGGAAGGAGGAAGGAGGG + Intergenic
947704192 2:232261208-232261230 TGGTGGGGAGGAAGGAAGGAAGG - Intronic
948463996 2:238143526-238143548 TGGCGGGAAAGGAGGCATGAGGG + Intronic
948479629 2:238241267-238241289 TAGTGGGGACTGAGGAAGGCAGG - Intergenic
948594996 2:239074053-239074075 GAGTGGGGAAGCAGGACTGAGGG + Intronic
948874031 2:240818035-240818057 CAGTGGGGAAGGGGGAAAGGAGG + Intronic
949085694 2:242152708-242152730 TAGTGGGGAGGGAAGAAAAAAGG - Intergenic
1168824765 20:802646-802668 AAAGGGGGAAGGAGGAATCAGGG - Intergenic
1168904938 20:1395484-1395506 AAGGGGGAAAGGAGGAATGGGGG + Intergenic
1168909706 20:1438088-1438110 TAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1168969498 20:1921263-1921285 TAATGTGGAAGGATTAATGAGGG - Intronic
1169024452 20:2357231-2357253 TACTGGGAAGGGAGGAATGTCGG - Intergenic
1169038441 20:2472435-2472457 GACTGGAGAAGGATGAATGAGGG - Intronic
1170100037 20:12688837-12688859 TAGTGGGGATTGAGGAAAGGTGG - Intergenic
1170255204 20:14334672-14334694 GAAGGGGGAAGGAGGAAAGACGG + Intronic
1170275216 20:14578551-14578573 TAATGTAAAAGGAGGAATGAAGG - Intronic
1170382864 20:15780964-15780986 AAAGGGAGAAGGAGGAATGAGGG - Intronic
1170463631 20:16602297-16602319 TAGTTGGAAAGGAGGAGAGATGG + Intergenic
1170501867 20:16982613-16982635 AAGTGGGGAGGGAGGAAGAAGGG - Intergenic
1170708571 20:18768119-18768141 AACATGGGAAGGAGGAATGAGGG - Intergenic
1170938273 20:20827982-20828004 GAGGGAGGAAGGAGGAAGGAAGG + Intergenic
1171201580 20:23246204-23246226 TAGTGGGTCAGGATGAAAGAGGG - Intergenic
1171346839 20:24471461-24471483 GAGAGGGGAGGGAGGAATTAAGG - Intronic
1171389186 20:24790236-24790258 GGGTGGGGGAGGAGGAGTGAGGG + Intergenic
1171986165 20:31662712-31662734 TAGTAGAGAAGGAGGTAAGAAGG - Intergenic
1172004949 20:31812673-31812695 GAATGGGAGAGGAGGAATGAAGG + Intergenic
1172009246 20:31836859-31836881 TAATGTGGAAGGGGGAATGTGGG + Intergenic
1172160244 20:32863034-32863056 CAGAGGGGAGGGAGGAATCATGG - Intronic
1172333011 20:34089052-34089074 TAGTGGCCAACGAGGAAGGAGGG + Exonic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1172858739 20:38030233-38030255 GAGGGAGGAAGGAGGAAGGAGGG + Intronic
1172993006 20:39049877-39049899 GAGTAGGGTAGGAGGAATGTTGG + Intergenic
1173207410 20:41005922-41005944 TAGTGGGAAAGGGTGAGTGAAGG - Intergenic
1173367249 20:42397451-42397473 TAGAGGGGAAGGGAGAATGGAGG - Intronic
1173912611 20:46681440-46681462 AAGAGGGGAAGGAGGGAGGAGGG + Intronic
1174092872 20:48063298-48063320 TGTTCTGGAAGGAGGAATGATGG - Intergenic
1174102348 20:48137383-48137405 TGGGGAGGAAGGAGGAATGGGGG - Intergenic
1174137554 20:48391035-48391057 AGGAGGGGAAGGAGGAAGGAAGG + Intergenic
1174262499 20:49306805-49306827 TAGTGAGGAAGGAAGAAAGTGGG + Intergenic
1174553280 20:51376492-51376514 TAGAGGGGCAGGAGGCATGAGGG + Intergenic
1175728588 20:61336398-61336420 TTGTGGTGGAGGAGGAATCAGGG - Intronic
1176274477 20:64255941-64255963 GGGTGGGGAAGGAGGAGGGAAGG - Intronic
1176548883 21:8213188-8213210 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1176556778 21:8257401-8257423 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1176567814 21:8396223-8396245 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1176575717 21:8440442-8440464 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1177031327 21:15984263-15984285 TAAGGGAGAAGGAGGAATGGAGG + Intergenic
1177097376 21:16853159-16853181 AAGTAGGGAGGGAGGAAGGAAGG + Intergenic
1177649248 21:23939443-23939465 TGGTGGGGTGGGAGGAAGGAGGG - Intergenic
1178310957 21:31529654-31529676 TATTTGGGAAGGAGCAATGCTGG - Intronic
1178700474 21:34829148-34829170 TAGTGGCTAAGAAAGAATGAGGG - Intronic
1178708996 21:34897698-34897720 TTATGGTGGAGGAGGAATGAGGG - Intronic
1178938267 21:36882897-36882919 GAGATGAGAAGGAGGAATGATGG - Intronic
1178998085 21:37425833-37425855 TTGTGCAGAAGGAGGCATGAGGG + Intronic
1180463995 22:15594381-15594403 AAGGAGGGAAGGAGGAAGGAAGG + Intergenic
1181577162 22:23802401-23802423 AGGGAGGGAAGGAGGAATGATGG - Intronic
1182116219 22:27757961-27757983 TAGTGGGGCAGGAGAAAAGTGGG - Intronic
1182318912 22:29465830-29465852 TAGGGGTGATGGAGGAATGTGGG - Intergenic
1182574948 22:31266724-31266746 AAGTGGGGAAGAAGGCAGGAGGG - Intronic
1182911319 22:33987024-33987046 GGGTGGGGAGGGAGGAATGCGGG + Intergenic
1183014749 22:34976949-34976971 CAGTGGAGAGGAAGGAATGAGGG - Intergenic
1183468549 22:37993058-37993080 GAGTGGGGAAGGTGGAGGGAAGG + Intronic
1183698768 22:39438088-39438110 GAAGGGGGAAGGAGGAATGGAGG - Intergenic
1183730455 22:39615580-39615602 TAGTTGGGAGGGAGGAATTGTGG - Intronic
1203253768 22_KI270733v1_random:129496-129518 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1203261824 22_KI270733v1_random:174575-174597 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
949180324 3:1122349-1122371 AAGGAGGGAAGGAGGAAGGAAGG + Intronic
949833709 3:8245063-8245085 TAGGGATGAAGGAGGAATGGGGG + Intergenic
950157928 3:10737842-10737864 AGGAGGAGAAGGAGGAATGATGG + Intergenic
950630117 3:14276677-14276699 AGGTGAGGAAGGAGGAAGGAGGG + Intergenic
950903595 3:16517779-16517801 CAGTGGGGGCGGGGGAATGATGG - Intergenic
951374005 3:21890284-21890306 AAGTGGGAAAGAAAGAATGATGG + Intronic
951595741 3:24316487-24316509 TGGTGGGGGAGGAGGAACAAGGG - Intronic
951853472 3:27169247-27169269 AAGTGAGGAATGAGGAATGTTGG + Intronic
952138064 3:30446036-30446058 TACTGAGGAAGGAGATATGAAGG + Intergenic
952204540 3:31167406-31167428 TAGAGGTGAAGGAGGAAGGAAGG - Intergenic
952513436 3:34079456-34079478 TAGAGGCGGAGGAGGTATGAAGG - Intergenic
952621001 3:35342397-35342419 GAGGGGGGAAGAAGGAAAGATGG + Intergenic
952913093 3:38207886-38207908 GAGGGGGGAGGGAGGAAGGACGG - Intronic
952987063 3:38794926-38794948 GAGAAGGGAAGGAGGAAAGAAGG - Intergenic
953389599 3:42526686-42526708 AAGTGGTTAAGGGGGAATGAGGG - Intronic
953496307 3:43390272-43390294 CAGTGGGGAAGGAGGAGGGGAGG - Intronic
953903660 3:46857566-46857588 AAGAGGGGAAGGAGAAATGTGGG + Intergenic
954036681 3:47854619-47854641 TACTGTGGAAGGAGGAAGGGAGG + Intronic
954917970 3:54164685-54164707 CAGTGGGGATGGGGGAAGGATGG + Intronic
955021565 3:55126635-55126657 TAGTGGGGAAGGGAGGAAGAAGG + Intergenic
955117638 3:56021714-56021736 GAGTGGGGAAGGTGGGAGGAGGG - Intronic
955169154 3:56546287-56546309 CAGTGGGGAAGGAGTAAACAAGG + Intergenic
955213776 3:56966504-56966526 TGGTGGGGAAGGAGGCAGAAAGG + Intronic
955703126 3:61701924-61701946 GAGGGAGGAAGGAGGAAGGAAGG + Intronic
955933027 3:64077023-64077045 AAGTGGGAAAGGAGGAAGGTGGG + Intergenic
956794356 3:72704551-72704573 TAGGGGAGAAGGAAGAAAGAAGG - Intergenic
957215612 3:77316898-77316920 TAGTGGAGAAGCAGGCATGAGGG + Intronic
957297448 3:78351211-78351233 AAGTGGGGAGGAAGGAAGGAAGG - Intergenic
958912196 3:100006388-100006410 TTATGGGGAAGGAGGAAAAAAGG - Intronic
959575872 3:107932865-107932887 AAGTAGAGAAGGAGGAATAAAGG - Intergenic
959981328 3:112521236-112521258 TAGTGGGGAAGGAAGAGTAGTGG - Intergenic
959981332 3:112521253-112521275 TAGTGGGGAAGGAAGAGTAGTGG - Intergenic
960265983 3:115621602-115621624 TAGTGGCTAAAGAGCAATGAAGG - Intergenic
960273419 3:115699357-115699379 TGGTGGGGGAAGAGGAAGGAAGG - Intronic
960421969 3:117457627-117457649 CAGTGTGTAAGGAGGAATGAAGG + Intergenic
960525435 3:118704826-118704848 GAGGGGGGAGGGAGGAAGGAAGG - Intergenic
961053571 3:123767710-123767732 GAGTGGGGAAGAAGTAAGGATGG + Intronic
961342304 3:126235808-126235830 TATTGAAGAAGGAAGAATGAAGG - Intergenic
962145573 3:132836301-132836323 TAGAGGCGGAGGAGGTATGAAGG - Intergenic
962413151 3:135159080-135159102 GGGTGGGGAAGGAGAAATGAGGG + Intronic
962962303 3:140321884-140321906 TCGTAGGAAAGGAGGACTGAAGG + Intronic
962979897 3:140478861-140478883 GAAGGGGGAAGGAGGAAGGAAGG + Intronic
963315367 3:143753100-143753122 GAGTGGGGAGAGAGGAGTGAAGG - Intronic
963521478 3:146363317-146363339 TAAGGGAGAAGGAGGAATGGAGG - Intergenic
964529681 3:157653940-157653962 GAAAAGGGAAGGAGGAATGACGG + Intronic
964814277 3:160700494-160700516 TTGGGGGGAAGGAAGAAGGATGG + Intergenic
964878179 3:161393792-161393814 TAGAAGGAAAGAAGGAATGAAGG + Intergenic
964903854 3:161693981-161694003 AAGGAGGGAAGGAGGAAGGAAGG - Intergenic
965057655 3:163743213-163743235 TAGTGGGGAGTGAGGAATAAAGG + Intergenic
965171115 3:165265673-165265695 GAGGGGGGAAGAAGGAAGGAAGG - Intergenic
965397795 3:168181220-168181242 TGGTGGGGAGTGGGGAATGAAGG + Intergenic
965451119 3:168839969-168839991 TAGTGGGGAAGGAGCCAGGGAGG - Intergenic
966242896 3:177774680-177774702 GAGGGGGAAAGGAGGAAGGAAGG - Intergenic
966332629 3:178831748-178831770 GAGTGTGGAGGGAGGAAGGAGGG + Intronic
966470899 3:180287836-180287858 AAGAGAGGAAGGAGGAAGGAAGG - Intergenic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
967005511 3:185378988-185379010 TAAGGGAAAAGGAGGAATGAAGG + Intronic
967350697 3:188511102-188511124 TAGGAAGGAAGGAGGAAGGAGGG - Intronic
967684235 3:192400741-192400763 TTGTGGAGATGGAGGAATGCTGG - Intronic
967687130 3:192430722-192430744 TAGGGTGAAAGGGGGAATGAGGG + Intronic
968481114 4:833486-833508 GAGGGGGAAAGGAGGAAGGAGGG + Intergenic
969178889 4:5422230-5422252 TAGTGGGGAAGGTGGAGTTAAGG + Intronic
969376115 4:6764344-6764366 GAGTGGGGAAAGAGAAAGGAAGG + Intergenic
970118678 4:12728327-12728349 TGCTGGAGAAAGAGGAATGAGGG - Intergenic
970338846 4:15083501-15083523 TAGTGGGGTATGTGGCATGAGGG - Intergenic
970444468 4:16112591-16112613 AAATGGGGAAGAAGGAAGGAAGG + Intergenic
970503429 4:16702512-16702534 AAGTAGGTAAGGAGAAATGAAGG + Intronic
970866114 4:20760705-20760727 CAGTGGGGAAGCTGGAATGTGGG + Intronic
972103200 4:35447707-35447729 TAGAGGGTAAGAAGGAAGGAAGG + Intergenic
972859156 4:43145981-43146003 TTTTTGGGAAGGGGGAATGAAGG + Intergenic
972874625 4:43343461-43343483 AAGGAGGGAGGGAGGAATGAAGG - Intergenic
973676378 4:53268056-53268078 CGGTAGGGCAGGAGGAATGAAGG + Intronic
973815936 4:54619012-54619034 ATGTGTGGCAGGAGGAATGAAGG - Intergenic
973925684 4:55735206-55735228 GAGTGGGGAGGGAGGAAGGGGGG + Intergenic
976014181 4:80530619-80530641 TAGAGGGGAAGGAGACAAGAAGG + Intronic
976466245 4:85372039-85372061 GAGTGGGGAGGGAGGGTTGAAGG + Intergenic
976558426 4:86475843-86475865 TAAGGGAGAAGGAGGAATGGAGG - Intronic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
978297283 4:107220570-107220592 GAGTGGGGAAGGAGGGAGGGAGG + Intronic
978382274 4:108141874-108141896 GGGTGGGGAAGCAAGAATGAAGG + Intronic
978730747 4:112023899-112023921 TTGTGGGAAAGGAAGAATCAAGG + Intergenic
979865066 4:125744137-125744159 AAGTGGGGAGGGAGGAAGGAAGG + Intergenic
979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG + Intergenic
980400885 4:132284514-132284536 TAGTGAGAGAGGAGGAAGGAAGG + Intergenic
980807145 4:137828324-137828346 AAGTGGGGAAGGAGGGAAGGAGG + Intergenic
980929433 4:139171268-139171290 TAGTTGGGAATGGGGAATGCAGG - Intronic
980991971 4:139745858-139745880 TCCTGGGGATGGAGGAAAGATGG + Intronic
981249700 4:142585062-142585084 TGGTGGTGGGGGAGGAATGAAGG + Intronic
982152784 4:152480543-152480565 TAGTGAGGAAGGAATGATGAAGG + Intronic
982594855 4:157368243-157368265 TAGTGGGAAAAAAGGAATTAAGG - Intergenic
982787753 4:159556198-159556220 AAGGGGGAAAGAAGGAATGAAGG - Intergenic
983503150 4:168523275-168523297 GAGGGGGGAGGGAGGAAGGAGGG + Intronic
983574924 4:169250684-169250706 TAGTGGGGATGGGGGTAGGAGGG + Intronic
984165499 4:176299299-176299321 TAAGGGAGAAGGAGGAATGGAGG + Intergenic
986347105 5:6845890-6845912 TAGTGAGGAGAGAGGAAAGAAGG + Intergenic
986555699 5:9008339-9008361 TGGAGAAGAAGGAGGAATGAAGG + Intergenic
987057763 5:14210939-14210961 GAGTGGGGAAGATGGAAAGAAGG - Intronic
987162420 5:15157829-15157851 AAGTGGGGAAGGAGGAAGATTGG + Intergenic
987219812 5:15779196-15779218 AGGTGAGGAAGGAGGGATGAAGG + Intronic
987335044 5:16891384-16891406 GAGAGAGGAAGGAGGAAGGAGGG + Intronic
987454733 5:18129556-18129578 TAGTGGTGAGGGAGGAAGAAGGG - Intergenic
987468353 5:18299320-18299342 TAGTGGAGCAGGAGGAAGAAAGG + Intergenic
987471548 5:18336458-18336480 TAGTAAGGAAGAAGGAATGGAGG + Intergenic
987755687 5:22096097-22096119 TAAGGGAGAAGGAGGAATGAAGG - Intronic
988417197 5:30960250-30960272 AAAGGGGGAAGGAGGAATGGGGG - Intergenic
988591018 5:32549576-32549598 TTGAGAGGAAGGAGGAATGAGGG - Intronic
988673261 5:33405124-33405146 TGGTGGGGGATGAGGAGTGAGGG + Intergenic
990159084 5:52916626-52916648 TAGAGGGGAAAGAAGACTGAAGG + Intronic
990217855 5:53553634-53553656 AAGTGGGTAAGGATGAATGCAGG + Intergenic
990298800 5:54430317-54430339 TAGAAGGAAAGGAGTAATGATGG + Intergenic
990300282 5:54442965-54442987 TACTGGTGAAGAAGAAATGAAGG + Intergenic
990323670 5:54653553-54653575 AAGTAGGGAAGGAGGAATCTGGG - Intergenic
990690247 5:58355743-58355765 TGAGGGGGAAGGAGGAAGGAAGG - Intergenic
991235080 5:64384645-64384667 TAGTGGGGAAGGGGAACTAAGGG - Intergenic
991380356 5:66016543-66016565 TAGTGGGGAGGAAAGAATGAAGG - Intronic
991436790 5:66604411-66604433 TACTGGGGAAGGGGGAATGATGG + Intronic
992081025 5:73234312-73234334 TGATGGGGGAGGAGGGATGAAGG - Intergenic
992388794 5:76311800-76311822 GACTGGGGACGGAGAAATGAGGG - Intronic
992452198 5:76885196-76885218 TAAGGGAGAAGGAGGAATGGAGG + Intronic
992535864 5:77702720-77702742 CATTGGGGAAGGAAGGATGAAGG + Intronic
993042727 5:82834057-82834079 CAGTGGGGAAGGAGGCAGGGTGG + Intergenic
993116185 5:83722332-83722354 TAGTGGGGCAGGAGGATGGGCGG + Intergenic
993974101 5:94455838-94455860 AAGTGGGGAAGGATGAAAAAAGG + Intronic
995131767 5:108638079-108638101 TAGGGGGGAAGGAGGGAACATGG + Intergenic
995766220 5:115622666-115622688 CAATGGGGAATGAGGAAAGATGG - Intronic
996011755 5:118488218-118488240 AAAAGGGGAAGGAGGATTGAAGG + Intergenic
996230344 5:121056105-121056127 GAGTAGGGAATGAAGAATGAAGG - Intergenic
996575159 5:124971071-124971093 TAAGGGAGAAGGAGGAATGGAGG + Intergenic
997033574 5:130160330-130160352 TAGTGGGCAAGGAGGAAAGCAGG - Intronic
997318585 5:132958913-132958935 TTGTTGGGTAGGAGGAATCAGGG - Intronic
998127004 5:139631038-139631060 AAGTGGGGAAGGAGGGAGGGAGG - Intergenic
998511682 5:142719012-142719034 TGGTGGGGAGGGAGGATGGATGG + Intergenic
1000593385 5:163185556-163185578 TAGCGGGTCAGGAGGAAGGAAGG + Intergenic
1000856449 5:166404027-166404049 GAGGGGGGAGGGAGGAAGGAAGG - Intergenic
1000903728 5:166937717-166937739 GAGAGGGGAAGGAGGAAAGAAGG + Intergenic
1000920685 5:167133194-167133216 AAGGAGGGAAGGAGGAAGGATGG + Intergenic
1001254897 5:170176009-170176031 AAGTGGGGGAGGAAGACTGAGGG - Intergenic
1001435781 5:171698253-171698275 GAGAGGGGAAAGAGGAATGAAGG + Intergenic
1002567948 5:180122821-180122843 TAGAGGGGAAGATGGAATGGGGG + Intronic
1002737831 5:181409576-181409598 TAGTGGGGAGGGAAGAAAAAAGG - Intergenic
1002902968 6:1425257-1425279 AAGGAAGGAAGGAGGAATGAAGG - Intergenic
1003298126 6:4852362-4852384 TAGGAAGGAAGGAGGAAGGAAGG - Intronic
1003637874 6:7850430-7850452 TAGTAAGGAGGGAGGGATGAAGG - Intronic
1003795125 6:9593151-9593173 TAGTAGGGAAGAAAAAATGATGG - Intergenic
1004278089 6:14255691-14255713 CAGTGGGGAAAGAGGCGTGATGG - Intergenic
1004751495 6:18566261-18566283 GAGTAGGGAATGAGGAAGGAAGG - Intergenic
1005563803 6:27068708-27068730 TAGTGAGGAATGAGGACTGAAGG + Intergenic
1005582189 6:27245974-27245996 GAGTGGGGAGGGAGGAAGGCAGG - Intergenic
1006827742 6:36948622-36948644 AAGGAGGGAAGGAGGAAGGAAGG - Intronic
1007102098 6:39256286-39256308 TACTGGGAAAGGAGGAAGGCTGG - Intergenic
1007210966 6:40193139-40193161 TAGGAGGGAGGGAGGAAGGAAGG - Intergenic
1007528439 6:42518497-42518519 TTGTGGGCAATGAAGAATGATGG - Intergenic
1007921363 6:45612461-45612483 TAGGGATGAAGGAGGAATCAAGG - Intronic
1008467604 6:51848017-51848039 TGGTGGAGTAGGTGGAATGATGG - Intronic
1008476377 6:51939418-51939440 TAAGGGAGAAGGAGGAATGGAGG - Intronic
1008478825 6:51962822-51962844 TATTAGGGGAGAAGGAATGAAGG - Intronic
1008551377 6:52635228-52635250 AAGCGGGGAAGCAGGAAGGAAGG - Intergenic
1009849190 6:69173717-69173739 TAGAGGGAATGGAAGAATGATGG + Intronic
1010168165 6:72941519-72941541 AAGGAGGGAAGGAGGAAGGAAGG - Intronic
1010465580 6:76164334-76164356 TAATGGAGATGGAGGAAGGAGGG - Intergenic
1010704409 6:79090173-79090195 AAGGAGGGAAGGAGGAAGGAAGG - Intergenic
1011187755 6:84697762-84697784 AAGTGAGGGAGGAGGAAGGAGGG + Intronic
1011275944 6:85631407-85631429 GAGTGGGGAAAGAGGTAAGAAGG + Intronic
1011382973 6:86762493-86762515 AGGTGGGCAAGGAGGAAAGAGGG - Intergenic
1012136654 6:95566018-95566040 TACTGGGGTAGGTGGAATAATGG + Intergenic
1012193858 6:96315419-96315441 CACTGGGGTAGGCGGAATGATGG + Intergenic
1012353970 6:98290226-98290248 TAGTGGGAAATGAGGGATTAAGG + Intergenic
1012728454 6:102847313-102847335 TAGTGTGGCAGGTAGAATGATGG - Intergenic
1013221476 6:108081364-108081386 TAGTGGGGAAGCAAGAATTTAGG + Intronic
1014120611 6:117721291-117721313 TAGTGGGGGAGGAGCCAAGATGG + Intergenic
1014494388 6:122102339-122102361 AAGTGGGGGAGGAGGAAGGAAGG + Intergenic
1014961554 6:127692472-127692494 TAGAGGAGAAGAAGGAATGTTGG + Intergenic
1015114092 6:129627641-129627663 TAGAGGGAAAGGAAGAAAGAAGG + Intronic
1015168846 6:130228826-130228848 CAGTGAGGAAGAAGGAATGTGGG - Intronic
1016744426 6:147562902-147562924 TGGGGAGGAAGGAGGAGTGAGGG - Intronic
1016799628 6:148155784-148155806 TAGTTGGGAAGGAGGAGAGTGGG - Intergenic
1017006523 6:150031572-150031594 TAGCGTGGAAGGTGCAATGATGG - Intergenic
1017041077 6:150309102-150309124 AAGAAGGGAAGGAGGAAGGAAGG + Intergenic
1017264192 6:152423429-152423451 TGGTGGGGAGGGAGGAGTGGGGG - Intronic
1017661237 6:156675963-156675985 TAATAGGGTGGGAGGAATGAAGG + Intergenic
1017963426 6:159242690-159242712 TTGGGAGGAGGGAGGAATGAGGG - Intronic
1018124514 6:160668959-160668981 TAATGGTGATGGTGGAATGATGG + Intergenic
1018504145 6:164445673-164445695 TACAGGGAAAGAAGGAATGAAGG + Intergenic
1018699534 6:166415850-166415872 TGGGGGTGATGGAGGAATGATGG - Intronic
1018921294 6:168177704-168177726 GCGTGGGGAAGGAGGCAGGAGGG - Intergenic
1019103334 6:169649748-169649770 TGGAGGGGATGGAGGAATGGAGG - Intronic
1019103571 6:169650737-169650759 TGGTGGGGATGGAGGGATGGAGG - Intronic
1019242930 6:170685134-170685156 TAGTGGGGAGGGAAGAAAAAAGG - Intergenic
1019397535 7:830097-830119 TAAGGGGGAAGGAGGAAGGAGGG + Intronic
1019664788 7:2246403-2246425 GAGTGTGGAAGGAGGGAGGAAGG + Intronic
1020989944 7:15184316-15184338 AAGGAGGGAAGGAGGAAGGAAGG + Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021226173 7:18029013-18029035 TAGTGAGGAAGGAGGCAGAAAGG + Intergenic
1021244290 7:18243084-18243106 TAGTGGGGAAAAAAGAAAGAAGG - Intronic
1021383686 7:20001587-20001609 AAATGGGGAGGGAGGGATGAGGG + Intergenic
1022854858 7:34304317-34304339 TAAGGGAGAAGGAGGAATGGAGG + Intergenic
1022868433 7:34447848-34447870 TAGTGAGGGAGAAGGAAGGAAGG + Intergenic
1022881273 7:34590196-34590218 TACTTGGGAAGGAGGAAAAAGGG - Intergenic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023279592 7:38555965-38555987 TTGTGGGGAAGGAGGAGGGAAGG + Intronic
1024221885 7:47295358-47295380 TATTGGGAGAGGAGGAATGATGG - Intronic
1024380954 7:48695321-48695343 AAGAGGGGAGGGAGGAAGGAAGG + Intergenic
1024391413 7:48816947-48816969 GAGTGGGGACAGAGGGATGAAGG + Intergenic
1024813772 7:53244117-53244139 AAGTGGGGAAGGGAGAATGGGGG - Intergenic
1026092309 7:67310741-67310763 TAGTGGGGAGGAAGAAATTAAGG - Intergenic
1026658240 7:72276031-72276053 AAGTTGGGAAGGAGGAAGGGGGG + Intronic
1027229692 7:76265050-76265072 TTGTGGGGTGGGAGGAAGGAGGG - Intronic
1027605567 7:80294307-80294329 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1027609645 7:80344431-80344453 TAGTTAGGCAGAAGGAATGAAGG + Intergenic
1027641251 7:80736168-80736190 GAGAGTGGAAGGCGGAATGAGGG + Intergenic
1028960243 7:96740474-96740496 AAGGGGAGAAGGAGGAAAGAAGG - Intergenic
1029118653 7:98251994-98252016 TCGCGGGGAGGGAGGAAGGAGGG - Intronic
1029204884 7:98863652-98863674 AAGGAGGGAAGGAGGAAGGAGGG - Intronic
1029204891 7:98863671-98863693 AAGCAGGGAAGGAGGAAGGAAGG - Intronic
1030286549 7:107832772-107832794 TAGTAGGGATAGAGAAATGAAGG + Intergenic
1030634837 7:111937018-111937040 CAGTGGGGAAGAAAGAAAGATGG + Intronic
1030698618 7:112614637-112614659 TAGTGGGGAGGGAGGAATGAGGG - Intergenic
1030770398 7:113468193-113468215 AAGGGAGGAAGGAGGAAGGAAGG - Intergenic
1030815809 7:114035986-114036008 TCCTAGGGAAGGAGGTATGAAGG - Intronic
1032002663 7:128275576-128275598 TAGCAGGGAAGGAGAAAAGAAGG + Intergenic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032675879 7:134129329-134129351 TAGAGGGGAGGGAGGAAGGGAGG - Intronic
1032698775 7:134360536-134360558 TTGTGGGGAAGCAGGAATGAGGG - Intergenic
1032720295 7:134546096-134546118 GATTGGGGATGGATGAATGATGG + Intergenic
1032815029 7:135464539-135464561 AAGTGGGGAGGGTGGAAGGAGGG + Intronic
1032838724 7:135697331-135697353 TAGAGGGGAAAGAGGAAGTATGG - Intronic
1033124101 7:138692316-138692338 TAGTGAGAAAGGAGTAGTGATGG + Intronic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1034117474 7:148596791-148596813 GAGTGGGGAAGGAGGAAGGGAGG - Intronic
1034310514 7:150083737-150083759 AGGTGGGCAAGGAGCAATGAAGG - Intergenic
1034336213 7:150325148-150325170 AAGTGGAAGAGGAGGAATGATGG - Intronic
1034796325 7:154016893-154016915 AGGTGGGCAAGGAGCAATGAAGG + Intronic
1034995124 7:155572135-155572157 AAGGAGGGAAGGAGGAAAGATGG + Intergenic
1034995147 7:155572215-155572237 AAGGAGGGAAGGAGGAAGGAAGG + Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035505191 8:123028-123050 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
1036663048 8:10720858-10720880 GAGGGGGGAAGGAGGGAGGAAGG - Intergenic
1036801178 8:11793953-11793975 AGGTGGGGAAGGGGGAATGTGGG + Intergenic
1037169413 8:15873908-15873930 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1037810088 8:22081753-22081775 CAGAGGGTGAGGAGGAATGAGGG + Exonic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037928404 8:22863216-22863238 TACTGGGGCAGCAGGAATGTGGG - Intronic
1037951314 8:23020015-23020037 CAGAGGGGAGGGAGGAAGGAAGG + Intronic
1038602267 8:28957406-28957428 GAGTGGGGAAGGAGGAAATCGGG + Intronic
1038893802 8:31757924-31757946 TAGAGGAGAAGGAGGAGTGAGGG - Intronic
1039306621 8:36270124-36270146 TAGTGGGTAAGGGGAATTGAGGG + Intergenic
1039423894 8:37469452-37469474 TAGGGTGGAAGGCGGAAGGAGGG - Intergenic
1039487905 8:37926364-37926386 GAGGGGGGAAGAAGGAAGGAAGG - Intergenic
1039812681 8:41063501-41063523 AAGGAGGGAAGGAGGAAGGAAGG + Intergenic
1040974947 8:53179841-53179863 TAGTTGGGGAGGAGGAGTAAAGG - Intergenic
1040996917 8:53411644-53411666 GAGAAGGGGAGGAGGAATGAAGG + Intergenic
1041304815 8:56447513-56447535 TGGTGGGGAGGGAGGGATGAGGG + Intergenic
1041498572 8:58514565-58514587 GACTGGGGAAAGAGGAAGGATGG - Intergenic
1041768014 8:61440516-61440538 TCTTGGAGAAGGAAGAATGACGG - Intronic
1042278553 8:67030077-67030099 TACTGGGGAAAGAGGAGAGATGG + Intronic
1042876619 8:73446283-73446305 TGGTGGGGAAGTAGGTGTGAGGG + Intronic
1043037755 8:75219021-75219043 TAGTTGGAAAGAAGGAAGGAAGG + Intergenic
1043590901 8:81832411-81832433 TAGTGGAGAAGGATGAAGGGGGG + Intronic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1044791301 8:95849772-95849794 CAGGGGAGAAGCAGGAATGAAGG + Intergenic
1045270882 8:100660637-100660659 TAGTGGGGAAGGCTGAATATAGG - Intronic
1045412086 8:101929546-101929568 GAGGGGGGAGGGAGGAAGGAAGG + Intronic
1045421475 8:102020932-102020954 GAGTGGGGAAGGAAGAAAGGTGG - Intronic
1046002426 8:108437131-108437153 CAGTGGGGATAGAGGTATGATGG - Intergenic
1046180596 8:110641761-110641783 TAGTAGGGAAAGAAGACTGATGG + Intergenic
1046312908 8:112462767-112462789 CAGAGGGGAAGGAGGAGTGGTGG - Intronic
1046719974 8:117608420-117608442 GAGGGGGGAAGGAGGAAGGAAGG - Intergenic
1047095499 8:121620690-121620712 TAGTGAGGCAGGAAGAGTGATGG - Intronic
1048161861 8:132028604-132028626 AAGGAGGGAAGGAGGAAGGAAGG + Intronic
1048291371 8:133184086-133184108 TTGCGGGGAGGGAGGCATGAGGG + Intergenic
1048492388 8:134906199-134906221 CAGTGGGGAAAGAGGGATGCTGG - Intergenic
1048837863 8:138538310-138538332 GAGTGGAGAAGAAGGAAGGAAGG + Intergenic
1049222073 8:141432828-141432850 TCGTGGGGCAGGAGAAATGGGGG + Intergenic
1049272397 8:141702883-141702905 GAGAGGGGAAGGAGGAAAGAAGG - Intergenic
1049317497 8:141977130-141977152 GAATGGGGAAGAATGAATGAGGG + Intergenic
1049365427 8:142234662-142234684 AGGTGAGGAAGGAGGAATGCTGG + Intronic
1049370376 8:142261409-142261431 GAGAGAGGAAGGAGGGATGAAGG + Intronic
1049575767 8:143388949-143388971 GAGTGGGGAAAGAGGAAGGGAGG + Intergenic
1050095590 9:2062099-2062121 AAGGGGGGAGGGAAGAATGATGG + Intronic
1050117448 9:2276836-2276858 TAAGGGAGAAGGAGGAATGGAGG - Intergenic
1050165171 9:2757886-2757908 TGGTGGGGTAGGGGGAAGGATGG + Intronic
1050429300 9:5545980-5546002 CAGTGGGGAAGCTGGACTGAGGG - Intronic
1050580347 9:7047965-7047987 TTGCTGGGAAGGAGGAGTGAAGG + Intronic
1050680845 9:8109663-8109685 TTGAGGGTAATGAGGAATGAGGG - Intergenic
1052653181 9:31327649-31327671 TAAGGGAGAAGGAGGAATGGAGG - Intergenic
1052947304 9:34178847-34178869 TAAGGGGGAAGGAGGAAAGGAGG - Intergenic
1052989413 9:34510377-34510399 TTCTGGGGAAGGAGGCAGGAAGG + Intronic
1053535324 9:38919966-38919988 TGGTGGGGAAATAGGAAGGAAGG + Intergenic
1053540111 9:38964956-38964978 AGGAGGGGAAGGAGGAAGGAAGG + Intergenic
1053595026 9:39551818-39551840 TAGTGAGAAAAGAGGAAAGAGGG - Intergenic
1053804461 9:41787113-41787135 AGGAGGGGAAGGAGGAAGGAAGG + Intergenic
1053852808 9:42306846-42306868 TAGTGAGAAAAGAGGAAAGAGGG - Intergenic
1054140823 9:61528349-61528371 AGGAGGGGAAGGAGGAAGGAAGG - Intergenic
1054626029 9:67398965-67398987 AGGAGGGGAAGGAGGAAGGAAGG - Intergenic
1054630807 9:67443984-67444006 TGGTGGGGAAATAGGAAGGAAGG - Intergenic
1054990907 9:71325629-71325651 TAGGCAGGAAGAAGGAATGAAGG + Intronic
1055188557 9:73488700-73488722 GAGTGGGGAACAAGGAATGGGGG + Intergenic
1055844204 9:80541435-80541457 AGGTGGGAAAGGAAGAATGAAGG + Intergenic
1056121659 9:83494164-83494186 TAGTGAGGCAGGAAGAATGAGGG - Intronic
1056122098 9:83498813-83498835 TAGTTGGGAAAGAGGATGGAAGG - Intronic
1056306595 9:85296676-85296698 TGGTGGGGAGGAAGGAAGGAAGG - Intergenic
1056486244 9:87060877-87060899 TCATGGGGAAGGAGGAAAGTTGG - Intergenic
1057082952 9:92186675-92186697 CAGAGGGGAAGAAGGAAGGATGG - Intergenic
1057221755 9:93261293-93261315 AAGTGGGGAAGGAGGAACCATGG - Intronic
1057745234 9:97745858-97745880 TAGTGGGTGAAGAGGAAAGAGGG - Intergenic
1058669271 9:107346924-107346946 AAGGGAGGAAGGAGGAAGGAAGG + Intergenic
1058925244 9:109656667-109656689 TAGAGGGCAAAGAGGAATTAGGG + Intronic
1058960462 9:109988557-109988579 GAGGGAGGAAGGAGGAAGGAAGG + Intronic
1059509164 9:114827970-114827992 AAGTGGGGAAGGAAGGAGGAAGG - Intergenic
1060003626 9:119980686-119980708 TGGTGGGGGATGAGGCATGATGG + Intergenic
1060718063 9:125953207-125953229 TGGTGGGGCAGTAGGACTGAGGG + Intronic
1061313617 9:129779969-129779991 GAGGGAGGAAGGAGGAAGGAAGG + Intergenic
1061509490 9:131051821-131051843 TACTGGGAAAGGAGGAGGGAGGG + Intronic
1061797668 9:133097865-133097887 TAGTGAGGAAGGAGGATTTGGGG - Exonic
1062154885 9:135041945-135041967 TGGAAGGGAAGGAGGAATGCTGG - Intergenic
1062252405 9:135604940-135604962 TAATGAGGAAGGAGGAAAGGAGG + Intergenic
1062437213 9:136551579-136551601 AAAGGGGGAAGGAGGAAGGAAGG - Intergenic
1062523752 9:136970074-136970096 GGATGGGGAAGGAGGAAGGAGGG + Intronic
1062702180 9:137913052-137913074 CAGTGGGGACACAGGAATGAAGG + Intronic
1203470168 Un_GL000220v1:112644-112666 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1203477989 Un_GL000220v1:156616-156638 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1203603121 Un_KI270748v1:34358-34380 TAGTGGGGAGGGAAGAAAAAAGG - Intergenic
1185603691 X:1355227-1355249 TGGAGGGGGAGGAGGAAGGAGGG + Intronic
1185627582 X:1493367-1493389 GAGGGAGGAAGGAGGAAGGAGGG + Intronic
1185927985 X:4168609-4168631 GGGTTGGGAAGGAGGAGTGAGGG - Intergenic
1185960835 X:4544912-4544934 TAAGGGAGAAGGAGGAATGGAGG + Intergenic
1186564138 X:10644364-10644386 CTGAGAGGAAGGAGGAATGAAGG - Intronic
1186623454 X:11266111-11266133 GAGTTGGGGAGGAGGAAAGAGGG + Intronic
1188816569 X:34722256-34722278 TGATGGGGAAGGAGTAAGGAGGG + Intergenic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189532192 X:41896923-41896945 TAGTGGGGGAGGAGGGAGTAGGG - Intronic
1189701724 X:43719866-43719888 TAGTGGGGAAACAGGAAGGTTGG + Intronic
1189885406 X:45539155-45539177 TAGTTGGGTGGGGGGAATGAGGG + Intergenic
1190117420 X:47635759-47635781 GAGTTGGGAGGGAGGAATGGGGG - Exonic
1190384423 X:49871144-49871166 TATGGGGGAAGGAGGAAATAGGG - Intergenic
1191871164 X:65746761-65746783 GAGTGAGAAAAGAGGAATGATGG - Intergenic
1192020332 X:67384465-67384487 GAGTGGGGAAGGAGTGGTGATGG - Intergenic
1192236182 X:69297605-69297627 GAGTGAGGAAGGAGAAAAGATGG - Intergenic
1193369153 X:80672420-80672442 GAGGGGGGAGGGAGGAATGAAGG + Exonic
1193454001 X:81706987-81707009 TTGTGGGGAATGAAGAAGGAAGG - Intergenic
1193501791 X:82285381-82285403 AAGGGGGAAAGAAGGAATGAAGG + Intergenic
1193665967 X:84317344-84317366 TAGTGGGGAAGGAATAAGAAAGG - Intergenic
1193973362 X:88085888-88085910 GAGTGTGGAAGGTGGAAGGAGGG - Intergenic
1194960474 X:100229524-100229546 AAGGGGGGAGGGAGGAATGAAGG - Intergenic
1195096574 X:101506847-101506869 GGGTGGGGAAGGATGAAGGAAGG - Intronic
1195897932 X:109767189-109767211 AAGGGAGGAAGGAGGAAGGAAGG + Intergenic
1195926580 X:110031758-110031780 TAGGGGGAAAGGAGGGATTAGGG - Intronic
1196039736 X:111189065-111189087 GAGTGAGGAAGGAGGGAGGAGGG - Intronic
1196049001 X:111285157-111285179 GAGTGAGGAAGGAGGTTTGAAGG + Intergenic
1196171149 X:112590120-112590142 TAGTGGGGGAGGAGCCAAGATGG + Intergenic
1197324953 X:125081526-125081548 TAGGAGGGAAAGAGGAATCAGGG - Intergenic
1197898095 X:131338846-131338868 AAGTTGGGAGGGAGGAAGGAAGG + Intronic
1198243442 X:134807036-134807058 CATTGGGGAAAGAGGAAGGAGGG + Intronic
1198325942 X:135573300-135573322 GTGAGAGGAAGGAGGAATGAAGG + Intronic
1198448954 X:136747149-136747171 TAGTGGGGAAAGGGAAGTGACGG + Intronic
1198509573 X:137336595-137336617 TAGTGGGAAAGGGGGGATGGTGG + Intergenic
1198686753 X:139235684-139235706 TAGAGGGGAAGAAGGAGTCAAGG - Intergenic
1198706177 X:139450838-139450860 AAGGAGGGAAGGAGGAAAGACGG + Intergenic
1198736560 X:139792101-139792123 ACCTGGGGAAGGAGGAAAGAGGG + Intronic
1198983896 X:142427999-142428021 TAAGGGAGAAGGAGGAATGGAGG + Intergenic
1199550656 X:149057501-149057523 TGGTGGAGAGGGAGGAAGGAGGG + Intergenic
1199617659 X:149670699-149670721 TGGTGGGGAGAGAGGAAGGAGGG - Intergenic
1199624984 X:149732550-149732572 TGGTGGGGAGAGAGGAAGGAGGG + Intergenic
1199653240 X:149969125-149969147 GAGGGAGAAAGGAGGAATGATGG - Intergenic
1199698482 X:150360454-150360476 TTGAAGGGAGGGAGGAATGAGGG + Intergenic
1199784678 X:151094063-151094085 TGGAGGGATAGGAGGAATGAAGG - Intergenic
1199825827 X:151498386-151498408 TGGTGGGGAGGGAGGAAGGAGGG + Intergenic
1199871716 X:151904384-151904406 TGGTGGGGAGGGAGGAAGGAGGG - Intergenic
1199896000 X:152128252-152128274 TGGTGGGGAGGGAGGAAGGAGGG + Intergenic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1199977054 X:152900323-152900345 GAGTAGGGAAGGAGGAAGGCAGG - Intergenic
1200184168 X:154170849-154170871 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200189821 X:154207977-154207999 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200195574 X:154245786-154245808 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200201227 X:154282907-154282929 TCGTGGGTCAGGAGGAAAGAAGG - Intronic
1200352213 X:155509975-155509997 AAGTTGGAGAGGAGGAATGATGG - Intronic
1200973339 Y:9179813-9179835 TAATGGGGGAAGAGGAATCATGG - Intergenic
1201011704 Y:9553253-9553275 TGGTGGGGAAGGAAGAAAGGAGG - Intergenic
1201691742 Y:16774853-16774875 AAGGAGGGAAGGAGGAAGGAAGG - Intergenic
1202137736 Y:21684699-21684721 TAATGGGGGAAGAGGAATCATGG + Intergenic
1202306214 Y:23473688-23473710 CAGTGTGGAAGGGGGAAAGATGG + Intergenic
1202349503 Y:23972662-23972684 TAGTGGGGAAAGAGGTTTTAAGG - Intergenic
1202521272 Y:25697442-25697464 TAGTGGGGAAAGAGGTTTTAAGG + Intergenic
1202564595 Y:26196901-26196923 CAGTGTGGAAGGGGGAAAGATGG - Intergenic