ID: 915704434

View in Genome Browser
Species Human (GRCh38)
Location 1:157830488-157830510
Sequence CAGTGGGACAGGAGGAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 637
Summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 582}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915704434 Original CRISPR CAGTGGGACAGGAGGAGAGT GGG (reversed) Intergenic
900553857 1:3270107-3270129 CAGTCGGAGAGGAGGACAGTCGG + Intronic
900553937 1:3270458-3270480 CAGTCGGCGAGGAGGACAGTCGG + Intronic
900554008 1:3270778-3270800 CAGTCCCAGAGGAGGAGAGTCGG + Intronic
900673143 1:3868321-3868343 CGGGGGGAGAGGAGGAGAGGAGG - Intronic
900686915 1:3954547-3954569 CAGAGGGGCGGGAGGAGAGGCGG - Intergenic
901469045 1:9442986-9443008 CAGGGAGACAGGAGGAAAGCAGG + Intergenic
901490703 1:9595008-9595030 CTGGGGGAGAGGTGGAGAGTCGG + Intronic
901650987 1:10743177-10743199 CTGGGGGACAGGAGGAGTCTGGG + Intronic
901660760 1:10796467-10796489 CACCGGGACAGGGGGAGAGACGG + Intronic
901686827 1:10947891-10947913 CTGTGGGCCAGGAGGAGTGGGGG - Exonic
901742306 1:11350303-11350325 CAGTGAGGCAGGAGGAGGGCTGG - Intergenic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902675931 1:18008551-18008573 AAGTGAGAGAGGAGGTGAGTGGG - Intergenic
902905320 1:19552393-19552415 GAGTGAGACAGGAAGACAGTGGG - Intergenic
902912987 1:19614843-19614865 CAGGAGGACAGCAGGAGAGGAGG - Intronic
903178626 1:21594663-21594685 AGGTGGGGCAGGAGGAGAGAGGG + Intergenic
903767011 1:25741516-25741538 CAGTGGGACGGCAGGAGGGCAGG - Intronic
904860370 1:33533249-33533271 CTGTTGGACTGGAGGAGATTAGG + Intronic
904862168 1:33546569-33546591 CAGTGGCACAGGAGAGGAGATGG - Intronic
904925816 1:34047420-34047442 AAATGGGACAGGAGGGGAGGAGG - Intronic
905031044 1:34884924-34884946 CTGGGAGACAGGAGGAGAGAGGG - Intronic
905322909 1:37130405-37130427 GGGTGGGACAGGAGGGGAGGAGG - Intergenic
906264987 1:44421792-44421814 CAGTGGGAGAGGTGGGGAGTAGG + Intronic
906299738 1:44673391-44673413 CAGTGAGACAGGAGGCGTGAAGG + Intronic
906822156 1:48940966-48940988 AATTGGGAAAGGAGGGGAGTGGG + Intronic
909152016 1:72018839-72018861 CAGTGTGATAGGAGGACATTGGG + Intronic
910407864 1:86909616-86909638 CACGGGGACAGGAGGAGTGGAGG + Intronic
910680092 1:89854102-89854124 CATTGGGACAGGAGAAGACGAGG + Intronic
910866759 1:91795718-91795740 GAGAGGGAAAGGAGGAGAGGAGG - Intronic
911258507 1:95660433-95660455 CTGTGGGCAAGTAGGAGAGTGGG - Intergenic
911924852 1:103817148-103817170 CTGAGGGACAGGAGCAGAGCTGG + Intergenic
912570891 1:110620201-110620223 CAGAGGGAAAGGAGAAGAGAGGG - Intronic
912619311 1:111139714-111139736 GCTTGGGGCAGGAGGAGAGTAGG + Exonic
913240396 1:116825237-116825259 CATTGGGAAAGGAGGAAAGGGGG - Intergenic
914343135 1:146776938-146776960 CAGTGAGAAATAAGGAGAGTGGG - Intergenic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915334110 1:155130482-155130504 GAGGGGGAGAGGAGGAGAGAGGG + Intronic
915704434 1:157830488-157830510 CAGTGGGACAGGAGGAGAGTGGG - Intergenic
916549541 1:165836950-165836972 CAGAAGGGCAGGAGGAGAGGAGG + Intronic
916671029 1:167020357-167020379 CACAGGCATAGGAGGAGAGTAGG - Intronic
916764878 1:167850598-167850620 GAGGGGAACAGGAGGAGTGTGGG + Intronic
917029326 1:170671758-170671780 CAGGGTGGCAGGAGGGGAGTGGG + Intronic
918042883 1:180923894-180923916 CAGTGGGGCAGGATGGGAGCTGG - Intronic
918146261 1:181758624-181758646 GTGTGGTACAGGAGGAGAGATGG - Intronic
919666006 1:200293183-200293205 CAGTGGGGCAGAAGGAAAATGGG + Intergenic
919676661 1:200390185-200390207 CAGCGGGACAGGACAACAGTGGG - Intergenic
919970036 1:202569934-202569956 CAGTGGGGCAGGGGGAGGGGAGG + Intronic
920696745 1:208186623-208186645 AAATGGGATAGGGGGAGAGTAGG + Intronic
921559930 1:216644885-216644907 CAGTAGGAAAGGAGAAGAGCAGG - Intronic
922660426 1:227425043-227425065 CAGTAGGACAGGAAGACTGTGGG + Intergenic
922776408 1:228216084-228216106 GAGGGGGAAAGGAGGAAAGTGGG - Intronic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
923419934 1:233802819-233802841 CAGTGGGAGAGGAGGAGAAGGGG + Intergenic
923891204 1:238216741-238216763 CAGTGGGGAAGGAGTAGAGTAGG + Intergenic
924049300 1:240064158-240064180 AAGTGGGAGGGGAGGGGAGTAGG + Intronic
924612000 1:245581073-245581095 CAATGGCACAGGAAGAGCGTTGG + Intronic
924759973 1:246974828-246974850 CGGTGGGTCAGCAGGAGAGGTGG - Intronic
1063112331 10:3047870-3047892 CAGAGAGAGAGGGGGAGAGTGGG - Intergenic
1063929009 10:11010395-11010417 CAGTTGGAAAGGAAGAGAGAAGG - Intronic
1064682134 10:17821014-17821036 CAGCTAGACAGGAGGAGATTGGG + Intronic
1066432846 10:35369235-35369257 CAGCGGGACAGGAACAGAGCAGG + Intronic
1066660692 10:37736480-37736502 CAGAGGGAGAGGAAGAGAGAGGG + Intergenic
1067323858 10:45247872-45247894 GGGTGGGAGAGGAGGAGAGAAGG - Intergenic
1067576483 10:47411986-47412008 CTCAGGGACAGGAGGAGAGATGG - Intergenic
1068131163 10:52896940-52896962 GAGGGTGACAGGAGGAGTGTGGG + Intergenic
1069814827 10:71187100-71187122 GAGAGGGAGAGGAGAAGAGTGGG - Intergenic
1070675821 10:78410565-78410587 CAGTGTCTCAGGAGGAGAGTGGG + Intergenic
1070920995 10:80186341-80186363 CAGTGTGACAGGTGGAGGATGGG + Intronic
1071011379 10:80944540-80944562 CAGTGGGATGGAAGCAGAGTTGG + Intergenic
1071188272 10:83069514-83069536 AAGTGGGAAAGGAAGAGAGAGGG + Intergenic
1071547337 10:86538498-86538520 CAGGGGGAGTGGGGGAGAGTGGG - Intergenic
1072004585 10:91232083-91232105 CAGTGAGATAGGAGGACAATGGG + Intronic
1072407909 10:95171639-95171661 GAGGGGCAGAGGAGGAGAGTAGG - Intergenic
1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG + Intronic
1073447577 10:103590572-103590594 CAGAGGGAGGGGAGGAGAGGAGG + Exonic
1074048771 10:109864101-109864123 TAATGGGACAGGAAGAAAGTAGG + Intergenic
1074084896 10:110202341-110202363 CAGTGGTTCAGTAGAAGAGTTGG + Intergenic
1074437194 10:113444254-113444276 CAGTGGGAAAGAAGGACAGAGGG - Intergenic
1075499249 10:122957239-122957261 GAGAGGGAAAGGAGGAGAGAAGG - Intronic
1076131644 10:128017822-128017844 CTGTGGTACAGGAGGTGGGTAGG + Intronic
1076569869 10:131425643-131425665 CAGTGGGACAGTAGCAGGGCTGG + Intergenic
1076824389 10:132959848-132959870 CCCTGGGACAGGAGGAGTGGAGG - Intergenic
1077508198 11:2941739-2941761 CAGCAGGACAGGAGCAGAGTGGG + Intergenic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077603016 11:3586908-3586930 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078051142 11:7965712-7965734 AAGTGGTAGAGGAGGAGTGTGGG - Intergenic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1078443603 11:11387413-11387435 CAGTTGCCCAGGAGGGGAGTGGG + Intronic
1078579382 11:12526829-12526851 CAGAGGGACAAGAGCAGAGAGGG + Intronic
1079870613 11:25794028-25794050 CAGTGGGACAGGAGCACACGAGG - Intergenic
1079890934 11:26052124-26052146 GACTGGAACAGGAGGAAAGTTGG + Intergenic
1079950094 11:26791173-26791195 TAATGGGACAGAAGAAGAGTGGG + Intergenic
1079993871 11:27274764-27274786 AGGTGGGACAGGAGGAGAAAAGG + Intergenic
1079993980 11:27275779-27275801 AGGTGGGACAGGAGGAGAAAAGG - Intergenic
1081727238 11:45339080-45339102 TAGTGAGAGAGGATGAGAGTAGG - Intergenic
1082029555 11:47594427-47594449 GAGGGGGAGAGGAGGGGAGTAGG + Exonic
1082988702 11:59189060-59189082 CTGCTGGAAAGGAGGAGAGTAGG + Intronic
1083803669 11:65060941-65060963 GTGTGGGGCAGGTGGAGAGTGGG - Intergenic
1083966096 11:66044866-66044888 CAGTGAGTCAGGAGTAGGGTTGG + Intronic
1084258896 11:67961446-67961468 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1084449165 11:69223045-69223067 GTGGGGGACACGAGGAGAGTAGG - Intergenic
1084456769 11:69272393-69272415 CAGTGGGACAGGTGGGCAGATGG - Intergenic
1084490221 11:69474389-69474411 CAGTTGGACTGGATGAGACTGGG + Intergenic
1084813851 11:71633732-71633754 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1085446479 11:76604232-76604254 CAGTGGAACAGGGGGAGTCTCGG - Intergenic
1086599726 11:88617892-88617914 GAGTGGGACAGGGAGACAGTAGG + Intronic
1087010875 11:93512968-93512990 CAGTGGGGCAAGAGGATGGTCGG + Intronic
1087375827 11:97338675-97338697 AAGTGGGGCATGAAGAGAGTGGG - Intergenic
1087605860 11:100376992-100377014 GAGGGGGAGAGGAGGAGAGGAGG + Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1087810394 11:102603842-102603864 CAGAGGGACCGCAGGAGAGATGG - Intronic
1088505403 11:110522296-110522318 GAGGGAGACAGGAGGAGAGGAGG - Intergenic
1089114706 11:116085217-116085239 GAGTGGGAAAGCAGGAGAGGAGG + Intergenic
1089133031 11:116226964-116226986 CAGTGGGAAAGGAGGAGGGGCGG + Intergenic
1089405513 11:118194207-118194229 CAATGAGACAGGAGGACAGCTGG + Exonic
1089492951 11:118895077-118895099 CAGGTGGGCAGGAGGAGAGAGGG - Exonic
1089528515 11:119112305-119112327 CTGTGGGACAAGAGGAGATGGGG - Intronic
1090799854 11:130163611-130163633 CAGTGGGTGAGGAAGAGGGTTGG + Intronic
1090844926 11:130522484-130522506 CAGAGGGACAGCAGGAGGGAGGG + Intergenic
1090898203 11:130999381-130999403 GAGAGGGAGAGGAGGAGAGGAGG + Intergenic
1091864053 12:3815001-3815023 CAGGAGGAAAGAAGGAGAGTAGG + Intronic
1091979289 12:4852729-4852751 CAGTGAGCCAGCAGGAGAGCAGG + Intergenic
1092131988 12:6119209-6119231 GTGCGGGACTGGAGGAGAGTAGG - Intronic
1092180268 12:6442122-6442144 CACTGGGCCAGGTGGAGGGTTGG + Intergenic
1092252947 12:6911341-6911363 CAGGGGGTCAGGATGAGAGTTGG - Intronic
1092430222 12:8402454-8402476 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1092928562 12:13294223-13294245 CAGTTGGCCTGTAGGAGAGTTGG - Intergenic
1093619017 12:21265004-21265026 CAGGAGGACATGAGGAGAGGAGG + Exonic
1095336510 12:41034478-41034500 AAGAGGGACAAGAGGATAGTAGG + Intronic
1095559161 12:43545109-43545131 CAGTGGGGAAGGAGAAGAGTGGG - Intronic
1095940564 12:47724251-47724273 CAGTGGGAGAGCATGAGGGTGGG - Intronic
1096242382 12:49966294-49966316 CAGTGGGACAAGAGCAGGCTAGG - Intergenic
1096271217 12:50167475-50167497 AAGTGGGCCGGGAGGAGAGATGG - Intronic
1096569974 12:52516861-52516883 CAGATAGAAAGGAGGAGAGTGGG + Intronic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097585813 12:61514868-61514890 CAGAGGTACAGGGGGAAAGTAGG + Intergenic
1098029813 12:66242244-66242266 CGGTGGGCCAGGAGGCGAGGTGG - Intronic
1099713293 12:86257242-86257264 CAGTGGGAGAGGAGGATAATGGG + Intronic
1099944277 12:89225996-89226018 CAGAGGGAGAGGAAGAGAGAGGG - Intergenic
1100754572 12:97736200-97736222 CAGTGGCACAGGAAGAATGTGGG + Intergenic
1101319597 12:103661878-103661900 AAGAGAGAGAGGAGGAGAGTGGG + Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102746516 12:115253547-115253569 GAGAGGGCCAGGAGGAGGGTGGG + Intergenic
1103320672 12:120091079-120091101 CAGTGGGCCATGAGGGGAGGCGG - Intronic
1103445089 12:120989199-120989221 CTGTGGGACGGGAGTAGACTTGG + Intronic
1103779772 12:123390381-123390403 CAGCTGGCCAGCAGGAGAGTCGG - Intronic
1104459396 12:128942636-128942658 AAGTGGGGCAGTAGGAGAGGTGG - Intronic
1105533528 13:21242741-21242763 CACGGGGACAGGAGAACAGTGGG - Intergenic
1105645396 13:22312633-22312655 CAGAGGAAGAGGAGGAGAGAGGG - Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1107434642 13:40371757-40371779 CAGGGAGAGATGAGGAGAGTGGG - Intergenic
1107673300 13:42769198-42769220 CAGTTGGGAAGGAGGAGATTTGG - Intergenic
1108611045 13:52084021-52084043 CAGAGTTAAAGGAGGAGAGTGGG - Intronic
1108792404 13:53987264-53987286 CAGTAGGACAGGATGATAATGGG - Intergenic
1111823509 13:93242326-93242348 CACTGGGACAGGAGGATGATAGG - Intronic
1112662134 13:101522003-101522025 CAGTGGGAGAGAAAGAGAGAGGG + Intronic
1112715623 13:102181536-102181558 CAGAGGCACAGGAGGAGAGGAGG + Intronic
1113120078 13:106916555-106916577 CAGCGGAATGGGAGGAGAGTGGG + Intergenic
1113530464 13:111020724-111020746 CTGGGGGACAGGAGGAGGGAGGG - Intergenic
1113732999 13:112655935-112655957 CAGGTGGACAGGAGGTGAGAGGG + Intronic
1113947239 13:114051166-114051188 GAGTGGGACAGGGCGAGAGGAGG - Intronic
1114303502 14:21399566-21399588 CAGTCGGAAAGGAGTAGAATAGG + Intronic
1115378433 14:32705341-32705363 CATTGGGAAGGGAAGAGAGTGGG + Intronic
1115583762 14:34788753-34788775 CAGTGCCACTGCAGGAGAGTTGG - Intronic
1116951802 14:50885162-50885184 CAGTGGGAGAGACGGAGAGCAGG - Intronic
1117135290 14:52729929-52729951 CGGTGGGACAGGACGAGTGAAGG - Intergenic
1117679596 14:58190044-58190066 GAGAGGGACAGGGGGAGAGAGGG + Intronic
1118348113 14:64954506-64954528 AAGGGGGACAGGAAGAGAGAAGG + Intronic
1118719903 14:68586552-68586574 CAGTGTGAGAGCAGGTGAGTGGG + Intronic
1120834875 14:89030519-89030541 GAGTGGCACAGGAGGTGTGTGGG - Intergenic
1121337043 14:93083835-93083857 CAGTGGGGCCTGAGGAGGGTGGG - Intronic
1121432121 14:93895092-93895114 GAGGGGGAGGGGAGGAGAGTGGG - Intergenic
1121488684 14:94342274-94342296 CAGTGGGACTAGAGGATTGTTGG + Intergenic
1121661016 14:95635177-95635199 CAATAGGAAAGGAGGAGAGGTGG - Intergenic
1121927154 14:97938160-97938182 CAGGGGGACAGGGGGAGACCTGG + Intronic
1122102524 14:99424677-99424699 CAGAGGGAGGGGAGGAGAGGAGG + Intronic
1122147749 14:99703329-99703351 GAGGGAGACAGGAGGAGGGTAGG - Intronic
1122148398 14:99707967-99707989 CAGTGGAACAGGAAGACAGAAGG - Intronic
1122206318 14:100149759-100149781 CAGTGGGAGCGGAGGAGGGCGGG - Intronic
1124191380 15:27580143-27580165 CAGTGGGACACAAAGAGAGCTGG - Intergenic
1124454352 15:29827009-29827031 CAGTGGCAGTGGAGCAGAGTGGG - Intronic
1124881107 15:33643546-33643568 GAGTAGGCGAGGAGGAGAGTGGG + Intronic
1125603780 15:40929006-40929028 TAATGGGGCAGGAGGTGAGTGGG - Intergenic
1127569666 15:60229748-60229770 CAGAGGGAGAGGAGAGGAGTCGG - Intergenic
1127862821 15:63008653-63008675 CAGTGTGACAGGAGCTGAGATGG + Intergenic
1127866973 15:63041468-63041490 CAGTGGGAGGGGAGGAGAGGGGG - Intergenic
1128111539 15:65079303-65079325 CAGGGAGAGAGGAGGAGACTAGG - Intergenic
1128499258 15:68215893-68215915 CAGTGGGACAGGAAAGGGGTAGG + Intronic
1128764247 15:70241439-70241461 CAGAGGGACAGGTGGCGAGGGGG + Intergenic
1128861981 15:71081834-71081856 TAGTGGCACAGGAGGAGCATGGG + Intergenic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129685424 15:77683718-77683740 CAGTGGGACATGGGCAGAGTGGG + Intronic
1130088096 15:80795395-80795417 CAGTGGGGAAGGAGAAGTGTGGG + Intronic
1130111117 15:80966581-80966603 CAGTGGCACAGCAGGAGGGGTGG - Intronic
1130232925 15:82110150-82110172 GAGTGTGACAGGAGGAGAGAAGG - Intergenic
1130443573 15:83978383-83978405 CAGTGGGAGAGGTGGAGGGATGG + Intronic
1130454188 15:84088689-84088711 CAGTGGGATCTGAGGAGAGATGG + Intergenic
1130580841 15:85135537-85135559 CAGTGGGGCAGGATGAGAACAGG - Intronic
1130924891 15:88377780-88377802 CAGTGGGACAGGGGGAGTGGGGG - Intergenic
1131403803 15:92147179-92147201 CAGGTGGAAAGGAGGAGAGGCGG - Intronic
1132120059 15:99168763-99168785 CAGTGGAGGAGGAGGAGAGGAGG - Intronic
1132158194 15:99511930-99511952 CAGTGGGAGAGCAGGAGAGCAGG + Intergenic
1132359623 15:101201567-101201589 CAGTGGGGTGGGAGGAGAGGAGG + Intronic
1132506900 16:314837-314859 CAGAGGGACAAGAGGACAGGTGG - Intronic
1132587878 16:714194-714216 CAGGTGGACAGGAAGAGAATGGG - Intronic
1133259509 16:4538873-4538895 CAGTGGGAGCGGAGGCGATTTGG + Intergenic
1134037562 16:11042402-11042424 GAGAGGGACAGGAGGACAGGAGG + Intronic
1134566108 16:15253216-15253238 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134627810 16:15735326-15735348 CAGTGGGATAGCAGGATGGTGGG + Intronic
1134736386 16:16503482-16503504 CAGTGGGACAGGATGGAAGCTGG - Intergenic
1134885257 16:17785228-17785250 CACTGGAAGAGGAGTAGAGTTGG - Intergenic
1134931129 16:18208686-18208708 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1135035993 16:19077246-19077268 AAATGGAACAGCAGGAGAGTTGG + Intronic
1135133975 16:19874273-19874295 CAGAGGGGCAAGAGGAGACTTGG - Intronic
1135313392 16:21422843-21422865 GAGGGGCAGAGGAGGAGAGTGGG - Intronic
1135366316 16:21855121-21855143 GAGGGGCAGAGGAGGAGAGTGGG - Intronic
1135445499 16:22516043-22516065 GAGGGGCAGAGGAGGAGAGTGGG + Intronic
1135470026 16:22721956-22721978 AAGTGGGGTAGGAGGAGAATCGG + Intergenic
1136071170 16:27788182-27788204 GAGTGGGAGAAGAGGAAAGTTGG - Exonic
1136152539 16:28360563-28360585 GAGGGGCAGAGGAGGAGAGTGGG - Intronic
1136210543 16:28754718-28754740 GAGGGGCAGAGGAGGAGAGTGGG + Intronic
1136310057 16:29401545-29401567 GAGGGGCAGAGGAGGAGAGTGGG - Intronic
1136323503 16:29503348-29503370 GAGGGGCAGAGGAGGAGAGTGGG - Intronic
1136438188 16:30243317-30243339 GAGGGGCAGAGGAGGAGAGTGGG - Intronic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1137768632 16:50996812-50996834 CAGTGGGGCTGGGGGAGGGTGGG - Intergenic
1137862921 16:51864904-51864926 AAGTGGGAGGGGAGGAGGGTAGG + Intergenic
1138213491 16:55182465-55182487 CAATTGCAGAGGAGGAGAGTTGG - Intergenic
1138213952 16:55186656-55186678 CAATTGCAGAGGAGGAGAGTTGG + Intergenic
1138288511 16:55828306-55828328 GAGTGGGCCAGGAGGTGTGTGGG - Intronic
1138442070 16:57041110-57041132 CAGAGGGACAGAGGGAGATTAGG - Intronic
1139857742 16:69993947-69993969 GAGGGGCAGAGGAGGAGAGTGGG - Intergenic
1139990856 16:70938390-70938412 CAGTGAGAAATAAGGAGAGTGGG + Intronic
1140473472 16:75227293-75227315 CTCTGGGAGAGGAGGTGAGTGGG + Intergenic
1141137712 16:81477506-81477528 CAGTGGGAAAGGAGGGGACCTGG - Intronic
1141285788 16:82670356-82670378 CAGTGGGGAAGGTGGAGAGAAGG - Intronic
1141394693 16:83694331-83694353 CAGTGGGAGAGAATGGGAGTGGG + Intronic
1142613263 17:1120827-1120849 CAGTGAGACAGTGGTAGAGTGGG + Intronic
1142958115 17:3535048-3535070 CAGAGGGGCAGGAGGGGAGGAGG - Intronic
1142968356 17:3594930-3594952 CAGTGGGACAGGAAGACAGGAGG + Intronic
1143276970 17:5718883-5718905 CAGTGGGATATGAGGAGTGGGGG + Intergenic
1143909660 17:10237258-10237280 CAGAGGGAGAGAAGGAGAGAGGG + Intergenic
1144465827 17:15496442-15496464 CAGTGGGGCAGGGGTGGAGTGGG - Intronic
1145747627 17:27332144-27332166 CAGCTGGACAGGAGGAGATCTGG - Intergenic
1145783185 17:27577460-27577482 CAGAGGGACAGGCAGAGAGGCGG - Intronic
1145875277 17:28314678-28314700 CAATGGGGCCGGAGGAGTGTGGG - Intergenic
1146813641 17:35924572-35924594 CACTGGGAGTGGAGGAGGGTAGG - Intronic
1147047989 17:37768917-37768939 CAGGAGCACAGGAGGAGAGAAGG + Intergenic
1148018650 17:44539632-44539654 AAGTGGGAAAGGAGGAGGGAAGG + Intergenic
1148106156 17:45120121-45120143 CACTGGGCCAGGAAGGGAGTGGG - Intronic
1148230116 17:45927527-45927549 CAGTGGGAGAGGTGGAGATATGG - Intronic
1148337500 17:46851508-46851530 CGCTGGGAAAGGAGGAGATTGGG - Intronic
1148347313 17:46912133-46912155 CCTTGGGACAGCAGGAGAGGAGG - Intergenic
1148541401 17:48483516-48483538 CAGTGGAACAGGAGGGGAATTGG - Intergenic
1149331793 17:55590281-55590303 TAGAGGGACAAGAGGAGAGAAGG + Intergenic
1149700465 17:58650801-58650823 CAGTGGGATAGGTGGAAAATTGG + Intronic
1151138135 17:71967159-71967181 CAGAGGGAGCAGAGGAGAGTGGG + Intergenic
1151295728 17:73184926-73184948 GAGTGAGGGAGGAGGAGAGTGGG + Intergenic
1152229827 17:79108867-79108889 CAGTGGGGCAGGCTGGGAGTGGG + Intronic
1152340300 17:79720726-79720748 CAGGGGGACATGGGGAGAGAAGG - Intergenic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1154097001 18:11426992-11427014 CTGGGCGACAGAAGGAGAGTCGG + Intergenic
1154119186 18:11637200-11637222 GAGGGGCAGAGGAGGAGAGTGGG - Intergenic
1155257719 18:24013992-24014014 CAGTGGGGCAGGAGGAGAAATGG - Intronic
1155267037 18:24104325-24104347 CAGTGGGGCAGGGGTGGAGTGGG - Intronic
1157242631 18:46025390-46025412 CAGTGGAGCTGGAAGAGAGTGGG - Intronic
1157371227 18:47114015-47114037 CCCTGGGACAGGATGAGAGGTGG - Intronic
1157495199 18:48152027-48152049 CAGTGGGCAAGGGGGTGAGTTGG + Intronic
1157523052 18:48358401-48358423 CAGTGTCACAGGGTGAGAGTGGG - Intronic
1157627369 18:49061683-49061705 CAGTGGGAACAGAGGAGAGCTGG + Intronic
1158409003 18:57187711-57187733 CAGTGGGACAGGATGGGATAGGG + Intergenic
1159054977 18:63454368-63454390 CTGTGGGAAAGGAGTAAAGTTGG - Intergenic
1159776623 18:72609938-72609960 CAGTGAGACAGGCGTAGAGGTGG - Intronic
1160511220 18:79454552-79454574 CAGCAGGGCAGGAGGAGGGTGGG + Intronic
1160980873 19:1816025-1816047 CAGCGGGACGGCAGGAGAGGCGG + Exonic
1161248930 19:3270381-3270403 CGGTGGGACAGATGGAGAGAGGG + Intronic
1161378346 19:3951275-3951297 CAGGGGGACGGGGGGAGAGATGG + Intergenic
1161410333 19:4113418-4113440 CAGATGGACAGGAGGGGAGGGGG + Intronic
1161726363 19:5931532-5931554 CTGTGGGAGGGAAGGAGAGTGGG + Intronic
1161994425 19:7703715-7703737 CATGGGGGCAGGATGAGAGTGGG - Intergenic
1162088295 19:8261658-8261680 CAGGGGGAGAGGAGGAGGCTGGG - Intronic
1162159658 19:8702467-8702489 GACTGGGGCAAGAGGAGAGTGGG - Intergenic
1163061275 19:14763932-14763954 GAGGAGGACAGGAGGAGAGGAGG - Intronic
1164244170 19:23416090-23416112 CAGTGGCACAGTTGGAGAGGAGG - Intergenic
1164609130 19:29620488-29620510 CAGGGAGGCAGGAGGAAAGTTGG - Intergenic
1165133344 19:33647270-33647292 CAGTGAGACAGGAAGAAAGCAGG + Intronic
1165176830 19:33936468-33936490 CAGAGGCAGAGGTGGAGAGTGGG - Intergenic
1165395454 19:35561298-35561320 CATGGGGACAGGAGGAGACATGG - Intronic
1166960040 19:46491802-46491824 CAGTGGGGCAGGCGGGGTGTGGG - Exonic
1167049242 19:47068543-47068565 CAGTGGGACAGCAGGAGGAGGGG - Intronic
1167163797 19:47784478-47784500 CCACGGGACAGGAGGAGGGTGGG - Exonic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1168015148 19:53566925-53566947 GAGAGGGAGAGGAGGAGAGAGGG - Intronic
1168414187 19:56158567-56158589 CAGGTGGAAAGGAGGACAGTGGG + Exonic
1168425143 19:56234098-56234120 CAGTAGGAGAGGAGGTGTGTGGG + Intronic
925110329 2:1330045-1330067 AGGTGGGAAAGGAGGAGAGGAGG + Intronic
926126773 2:10277025-10277047 AAGCTGGGCAGGAGGAGAGTGGG + Intergenic
926197582 2:10773060-10773082 CACAGTGACAGGAGGAGAGCGGG + Intronic
926381437 2:12294497-12294519 CAGAGTGACCGGAGGTGAGTGGG + Intergenic
926388647 2:12364100-12364122 CACTAGGATAGGAGGAGAGCAGG + Intergenic
926612344 2:14958945-14958967 CAGTGGGAAAGGAGGAAGGGTGG + Intergenic
926982042 2:18583257-18583279 CTGGGGGACAGGTAGAGAGTAGG + Intronic
927384779 2:22520580-22520602 CAGAGGGATAGGAGGAGATGAGG - Intergenic
927706665 2:25300339-25300361 TCGTGGGACAGGAGGAGGCTGGG - Intronic
927943438 2:27120033-27120055 GAGGAGGACAGGATGAGAGTGGG - Intergenic
929191773 2:39146925-39146947 CAGTGGGACTGGGGGAAAGCAGG - Intergenic
929263553 2:39893711-39893733 GAGAGGGACAGGAAGAGATTTGG + Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929890594 2:45915830-45915852 CAGTGGGAGAGGAGGATGCTTGG - Intronic
929891236 2:45919942-45919964 CACTGGGACAGTGGGAGAGGAGG + Intronic
929931114 2:46256247-46256269 CAGGGGGACCTGAGGAGAGTTGG + Intergenic
929961085 2:46496798-46496820 CAGTGTGACAGGAGGAGGGCAGG + Intronic
931430542 2:62205729-62205751 CAGTGTGAGAGGAGGAGCGCTGG + Intronic
931432162 2:62216725-62216747 CGGTGGGACAGTAGGAAAATGGG + Intronic
931797873 2:65729076-65729098 CTGAGTGACAGGAGGAGAGAAGG + Intergenic
932599035 2:73111757-73111779 CAGAGGGACAGGATGGGGGTGGG + Intronic
932932062 2:76052988-76053010 CAATGGGACAAAAGGAGATTAGG + Intergenic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
933770529 2:85741380-85741402 CCGTGAGACAGGACGAGAGCAGG - Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935066184 2:99650597-99650619 CAGTGGGAGAAGGGCAGAGTGGG + Intronic
935272268 2:101445179-101445201 CAGTGGGTGAGCAGGAGGGTGGG - Intronic
935499555 2:103821668-103821690 CAGTGTGTCAGGAGCTGAGTGGG - Intergenic
935797481 2:106658773-106658795 CAGTGGCACAAGAGCAGTGTTGG - Intergenic
936639728 2:114298507-114298529 GAGAGGGAGAGAAGGAGAGTGGG + Intergenic
937021613 2:118662150-118662172 GAGTGGGGTGGGAGGAGAGTGGG - Intergenic
937206207 2:120238696-120238718 CAGTGGGGCAGGAGGAGGACAGG + Intergenic
938043447 2:128095498-128095520 GAGCAGGACAGGAGGAGAGTGGG - Intronic
938935900 2:136127424-136127446 AAGTGGGACAGCAGGAGGGTGGG - Intergenic
942179969 2:173370974-173370996 CAGTGGGACAGTAGGAAACCAGG + Intergenic
942184251 2:173408982-173409004 CAGTGGGAGGGCAAGAGAGTGGG + Intergenic
942611167 2:177744011-177744033 CAGGGGCAGAGGAGGAGAGGAGG - Intronic
943809297 2:192164189-192164211 AAGTGGTAGAAGAGGAGAGTAGG - Intronic
944227638 2:197364187-197364209 AGGTGGGACAGGAAGAGGGTGGG - Intergenic
947139624 2:227009041-227009063 CAGAGGGAGAGAAGGAGAGAAGG + Intronic
947605224 2:231481698-231481720 CAGGGGAACAGGTGGAGAATAGG - Intronic
947815184 2:233032079-233032101 CAGTGGGAAAGGAAGAGACAGGG - Intergenic
947871883 2:233443699-233443721 CAGTGGCTCAGGAGGAGAAGTGG + Intronic
948025282 2:234771554-234771576 AAGTAGGACAGGAGGAAGGTAGG + Intergenic
948042732 2:234916606-234916628 AACTGGGCAAGGAGGAGAGTGGG + Intergenic
948915718 2:241034297-241034319 CAGGTGGCCAGGAGGTGAGTGGG - Intronic
1168857432 20:1018584-1018606 CAGTGGGGCTGGAAAAGAGTGGG - Intergenic
1169025145 20:2364472-2364494 CAGTAGGACAGAGGGAGTGTAGG + Intergenic
1169609094 20:7359167-7359189 CAAAGAGAGAGGAGGAGAGTGGG + Intergenic
1170066843 20:12320300-12320322 GATGGGGACAGGAGGAAAGTGGG + Intergenic
1170073938 20:12398515-12398537 GAGAGGGAGAGGAGGATAGTAGG + Intergenic
1170327345 20:15171296-15171318 CAGTGGTGGAGGAGGAGAGATGG - Intronic
1170370119 20:15639455-15639477 CAGTGGGGGCTGAGGAGAGTAGG - Intronic
1170463631 20:16602297-16602319 TAGTTGGAAAGGAGGAGAGATGG + Intergenic
1170497541 20:16940812-16940834 CAGTGGGAGAAGAGGAGACGTGG - Intergenic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1172408724 20:34707179-34707201 CAGTGAGACAGCAGGTCAGTGGG - Intronic
1172446920 20:34998059-34998081 CAGTGGGTCAGGGTGAGAGTTGG - Intronic
1172848363 20:37943918-37943940 CAGTGGGGGAGAAGAAGAGTCGG - Intronic
1172977511 20:38918088-38918110 CAGAGAGACAGGTGGATAGTAGG + Intronic
1173077412 20:39832769-39832791 CAGTGAGGCAGGGAGAGAGTAGG - Intergenic
1173361230 20:42346369-42346391 CAGTGTGACAGGTGGGGCGTGGG + Intronic
1173465963 20:43281638-43281660 GAGAGGGACAGTAGGAGAGAGGG - Intergenic
1173760416 20:45554800-45554822 CAGTTGGTCAGGAGTAGAGGTGG - Intronic
1173951673 20:46998344-46998366 CAGTGTGACAGGTGGAGAAGTGG - Intronic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1175048343 20:56128325-56128347 GAGTGGGACAGGTGGGGACTAGG + Intergenic
1175129183 20:56776438-56776460 CAGTGGCGCTGGAGGAGGGTGGG - Intergenic
1175977076 20:62716390-62716412 CGTTGGGACAGGAGGAAGGTCGG + Intronic
1177600076 21:23299367-23299389 CCGTGGGACAGAAGGAGTGGAGG - Intergenic
1178330870 21:31689981-31690003 CAGAGGAACAGGAGGAGCATAGG - Intronic
1178430263 21:32512561-32512583 CACTGGGAGAGGAGGGGAGGGGG + Intronic
1178794030 21:35727001-35727023 CTGTGGGCAAGGAGGAGGGTAGG - Intronic
1179025288 21:37674495-37674517 CAGTGGGTGAGGAGGGGAGTGGG - Intronic
1179392652 21:41008128-41008150 CATGGGGACAGGAGGTGAGTGGG + Intergenic
1179883353 21:44302608-44302630 CAGCCGGGCAGCAGGAGAGTGGG + Intronic
1180157342 21:45983975-45983997 CAGTGGGGCAGCATGACAGTGGG - Intronic
1180998974 22:19979162-19979184 AGCTGGGACATGAGGAGAGTGGG - Intronic
1181967350 22:26666508-26666530 CAGTGTGGCAGGAGCAGAGCTGG + Intergenic
1182048964 22:27298817-27298839 AAGAGAGAAAGGAGGAGAGTGGG + Intergenic
1182116219 22:27757961-27757983 TAGTGGGGCAGGAGAAAAGTGGG - Intronic
1182707408 22:32294547-32294569 GGGTGGGGCAGGAGGAAAGTGGG - Intergenic
1182819341 22:33201628-33201650 CAGAGGGACAGGAGGGAATTTGG + Intronic
1182907792 22:33953353-33953375 CACTGAGACAGGAGGAGGGCAGG - Intergenic
1182985046 22:34708283-34708305 CAGTGGGAGAGGAGCACAGAAGG - Intergenic
1183163746 22:36132192-36132214 GAGCGGGAGAGGAGGAGAGAAGG + Intergenic
1183227315 22:36559293-36559315 AAGTGGGAAAGGAGGAGGGGTGG + Intergenic
1183744153 22:39683836-39683858 CTGTGGGACAGCAGGTGGGTTGG - Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184154442 22:42657916-42657938 CAGGGGGATGGGAGGACAGTGGG + Intergenic
1184395749 22:44238000-44238022 GGGTGGGGCAGGAGGAAAGTGGG - Intergenic
1184416271 22:44353473-44353495 CAGTGGGACAGCAACAGAGCTGG + Intergenic
1184900767 22:47445181-47445203 CAGGAGGACAGGAGGATAGGTGG - Intergenic
1184900778 22:47445229-47445251 CAGGTGGACAGGAGGACAGGTGG - Intergenic
1184900840 22:47445531-47445553 CAGGTGGACAGGAGGACAGGTGG - Intergenic
1185331954 22:50255913-50255935 CAGGGGGACAGGATGAGACGGGG + Intronic
1185342220 22:50296798-50296820 CGGTGGGGTGGGAGGAGAGTGGG - Intronic
950124304 3:10502061-10502083 CAGTGGGACAGCAGGCGGATGGG + Intronic
950143678 3:10632889-10632911 CAGGGTGAGAGGAGGAGAGCAGG - Intronic
950167827 3:10815036-10815058 CCGAGGGACAGATGGAGAGTAGG + Intergenic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950991468 3:17442823-17442845 AACTGGAACAGCAGGAGAGTTGG + Intronic
951257922 3:20472143-20472165 TAGTGAGGCATGAGGAGAGTAGG + Intergenic
951857259 3:27211601-27211623 GGGTGGGACAGGGTGAGAGTAGG - Intronic
952190985 3:31023474-31023496 CAGTGGAACAGGAGGAAGGGAGG - Intergenic
952573678 3:34748213-34748235 GAGTGAAACAGGAGGAGAGAAGG + Intergenic
953031065 3:39180351-39180373 ATGTGGGTGAGGAGGAGAGTGGG + Intergenic
953384993 3:42501435-42501457 CCGTGTGACAGAAGGAGAGGCGG - Intronic
953496307 3:43390272-43390294 CAGTGGGGAAGGAGGAGGGGAGG - Intronic
953576973 3:44120734-44120756 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
953769989 3:45772413-45772435 AAGAGGGAAAGGTGGAGAGTGGG - Intronic
954008877 3:47616977-47616999 CAGTGGGGGAGGTGGAGAGTTGG + Intronic
954386824 3:50248509-50248531 AAGGGGGACAGGAGCAGAGGTGG - Intronic
954482971 3:50818661-50818683 CACTGGGACAGGAAGGGAGAGGG + Intronic
954926784 3:54243007-54243029 CAGAGATACAGGAGGAGATTTGG + Intronic
955829596 3:62986932-62986954 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
955933027 3:64077023-64077045 AAGTGGGAAAGGAGGAAGGTGGG + Intergenic
956045382 3:65190544-65190566 CAGTGAGACAGGAGTAGGCTAGG - Intergenic
956682096 3:71790439-71790461 CAGTGTGGCAGGAGCAGAGCTGG - Intergenic
956771617 3:72531291-72531313 AAGAGGGACAGGAAGAGAATTGG + Intergenic
957017317 3:75083172-75083194 GAGTGGGGGAGGAGCAGAGTGGG + Intergenic
957824512 3:85423207-85423229 GAGTGGCACAGGAGAAGAGTAGG - Intronic
960192768 3:114726942-114726964 CAGTGAGATAAGAGAAGAGTTGG + Intronic
960985863 3:123280253-123280275 CACAGGATCAGGAGGAGAGTTGG - Intergenic
961123920 3:124398876-124398898 CAGGGGGCCAGGAGGGGAGGTGG + Intronic
961280237 3:125760754-125760776 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
961352936 3:126315554-126315576 AGGGGGGACAGGAGGAGAGCGGG + Intergenic
961830682 3:129621567-129621589 CAGTGGCACAGAAGGAGTGTGGG - Intergenic
961874169 3:130008793-130008815 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
963412708 3:144951926-144951948 CAGTCAGACATGAGCAGAGTGGG - Intergenic
964811670 3:160671069-160671091 CAAGGGGACAGAAGGAGAGTAGG + Intergenic
966731833 3:183158115-183158137 CACAGGGAGAAGAGGAGAGTGGG - Intronic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967155713 3:186690165-186690187 CAGTGAGGCAGGTGGAGAGGGGG - Intergenic
967157002 3:186702330-186702352 CAGTGAGGCAGGTGGAGAGGGGG - Intergenic
967253967 3:187571023-187571045 CAGTAGGACAGGAGGATGGCAGG - Intergenic
967811804 3:193766877-193766899 CAGTGGGACCGGAGGAGTCAGGG - Intergenic
968598995 4:1500377-1500399 CACTGGGACTGGGGCAGAGTAGG + Intergenic
968649023 4:1753135-1753157 CAAGGGGACAGCAGGAGAGAAGG - Intergenic
968794928 4:2697048-2697070 CAGTGGGACAAGAGCAGCATGGG - Intronic
969444594 4:7237085-7237107 CAGTGGTGCAGGAGGAGTTTGGG + Intronic
969736512 4:8995029-8995051 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
970504499 4:16713716-16713738 TAGTGGGACAAGAGGAGGGATGG + Intronic
970515806 4:16829057-16829079 CAGTGAGGGAGGAGGGGAGTGGG - Intronic
971229634 4:24790610-24790632 CAGGGGGACAGGTGAAGAGATGG + Intronic
972341236 4:38154357-38154379 CGGGGGGGCAGGAGGTGAGTCGG + Intergenic
972356280 4:38281928-38281950 AAGAGAGACAGGAGGAGAGAAGG - Intergenic
972686663 4:41359665-41359687 GAGTGGGACAAGAGGAGATGAGG + Intronic
973133390 4:46676142-46676164 CTGTGGGACAAGAGGAGAAATGG - Intergenic
973652950 4:53015066-53015088 CAGTGAGTCAGGAGGAGAAAAGG + Intronic
975037709 4:69704792-69704814 TGGTGGGAGATGAGGAGAGTGGG + Intergenic
975114923 4:70669871-70669893 CAGTGAGACAGGAGGAAAACAGG - Intronic
975859183 4:78658145-78658167 CACTGAGACAGGAGCAGACTGGG + Intergenic
975957539 4:79859269-79859291 GAGTGGGAAAGGAGGTGAGAGGG - Intergenic
976074439 4:81281222-81281244 CAGAGGGACAGTAGGAATGTAGG - Intergenic
980609221 4:135135782-135135804 CAGAGAAAAAGGAGGAGAGTTGG + Intergenic
981382607 4:144090631-144090653 CAGTGGGATGGATGGAGAGTTGG - Intergenic
981812613 4:148792978-148793000 CAGTGGGAAAGGAGGAACCTGGG - Intergenic
982209078 4:153020485-153020507 GAGTGGGGAAGGAGGGGAGTGGG - Intergenic
982220318 4:153119124-153119146 CAGCTGGACAGGAGGGGAGAGGG - Intergenic
982873249 4:160611378-160611400 GCGTGGGACAGGAGGAGGGTGGG - Intergenic
983365072 4:166776086-166776108 CAGAGGGACAGAAGGAGAGGAGG + Intronic
984163938 4:176285754-176285776 CAGTGGATCAGGAGGAGAGGAGG + Intergenic
984340850 4:178454155-178454177 CATTAGGACAGGAGGTTAGTTGG + Intergenic
984856798 4:184202419-184202441 GAGTGGAACAGGAGGGGAGGAGG + Intronic
984930122 4:184839600-184839622 AAGTGTGACTGCAGGAGAGTTGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985841969 5:2313313-2313335 CAGAGGCTCAGGAGGAGGGTGGG - Intergenic
985962889 5:3316255-3316277 CTGGGGGACAGGAGGAGATAGGG - Intergenic
986546743 5:8906012-8906034 CTGTGGGACAGCAGGTGAGGGGG - Intergenic
986865097 5:11976837-11976859 AAGGGGGACAGGAGGAGGGAAGG - Intergenic
988674994 5:33424004-33424026 CACTGGGACTGCAGGAGACTGGG - Intergenic
989804689 5:45588562-45588584 TGGTGGGGCAGGAGGTGAGTAGG - Intronic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
992219562 5:74558286-74558308 AAGAAGGAAAGGAGGAGAGTGGG + Intergenic
992547836 5:77832483-77832505 CAGTGGGACTAGAGGCGAGGAGG - Intronic
994214932 5:97127016-97127038 GGGAGGGAAAGGAGGAGAGTAGG - Intronic
994242272 5:97438014-97438036 CAGTGGGAAAGGATCAGAATTGG - Intergenic
995144664 5:108773343-108773365 CTGTGGGACAGCAGGGGTGTGGG - Intronic
996183870 5:120452678-120452700 CACTGGGGCATGAGGAGGGTGGG - Intergenic
996457724 5:123703937-123703959 AAGTGGGGGAGGAGGAGAGTAGG + Intergenic
997658070 5:135569892-135569914 CAGGTGGACAGGTGGACAGTAGG - Intergenic
998638304 5:143981710-143981732 AAGTAGGATATGAGGAGAGTGGG - Intergenic
998937099 5:147240906-147240928 CAGTGAGAAAGGTGGAAAGTAGG + Intronic
999459402 5:151744977-151744999 CAGTGTGAAATGAGGAAAGTTGG + Intronic
999663371 5:153888645-153888667 CAGTGGGCAAGGGTGAGAGTGGG + Intergenic
999829906 5:155308437-155308459 CACTGTGACAGGAGGATGGTGGG + Intergenic
999942269 5:156556360-156556382 CATTGGGACAGCAGGAGTCTGGG - Intronic
1000086202 5:157889536-157889558 GCCTGGGACAGGAGGAGAGGTGG - Intergenic
1000975453 5:167759581-167759603 CAGAGGGACGTGAGGAGAGATGG + Intronic
1001673122 5:173490927-173490949 CAGTGGAGCAGGTGGGGAGTGGG + Intergenic
1001706015 5:173741694-173741716 CAGGGGGACAGGGGGACAGGGGG + Intergenic
1001706019 5:173741702-173741724 CAGGGGGACAGGGGGACAGGGGG + Intergenic
1001706023 5:173741710-173741732 CAGGGGGACAGGGGGACAGGGGG + Intergenic
1001706027 5:173741718-173741740 CAGGGGGACAGGGGGATAGGGGG + Intergenic
1001706035 5:173741734-173741756 TAGGGGGACAGGGGGAGAGGGGG + Intergenic
1001706039 5:173741742-173741764 CAGGGGGAGAGGGGGAGAGGGGG + Intergenic
1003533540 6:6956785-6956807 AAGTGAGGCAGGATGAGAGTTGG - Intergenic
1004003850 6:11621424-11621446 CAGAGGGACATGGGGAGAGAAGG - Intergenic
1004164016 6:13239825-13239847 CTGTGTGTCAGGAGGAGAGGAGG + Intronic
1004383152 6:15149571-15149593 CAGAGGGACAGGAGGAAAGAGGG + Intergenic
1004755032 6:18601710-18601732 CACTGTGACAGGAGCAGTGTGGG + Intergenic
1005355473 6:24979191-24979213 CAGTGGGAGTGGAGCAGAGAGGG - Intronic
1005976276 6:30802290-30802312 CAGTGGGACATGAGGATGCTGGG + Intergenic
1006441177 6:34054617-34054639 GAGAGGGACAGGAGGGGAGAAGG - Intronic
1007610586 6:43146393-43146415 CAGTTAGAAAGGAGGAGAATTGG - Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008497822 6:52151057-52151079 AAGTGGCACAGCTGGAGAGTGGG - Intergenic
1009758085 6:67966951-67966973 GAGTGGGAAAGGAGGAGGCTAGG + Intergenic
1009814246 6:68710578-68710600 CATTGTGTCAGGAGGAGAGAAGG - Intronic
1010973354 6:82286621-82286643 AAGTGGGACAGGAAGGAAGTGGG + Intergenic
1011249150 6:85352678-85352700 CAGTGGGACAAGATGGGAGGTGG - Intergenic
1013619712 6:111875848-111875870 CAGAGAGAGAGGAGGAGAGAGGG - Intergenic
1013634454 6:112016031-112016053 CAGAGCGACAGGGGAAGAGTAGG + Intergenic
1014633648 6:123817729-123817751 CAGTGGTAAATGAGGAGAGCAGG + Intronic
1015062664 6:128985703-128985725 CAGTGGGAAAGGAGAACAGTTGG - Intronic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1016594247 6:145781508-145781530 CCATGGGACAGGATCAGAGTGGG - Intergenic
1016799628 6:148155784-148155806 TAGTTGGGAAGGAGGAGAGTGGG - Intergenic
1016913133 6:149218571-149218593 CAGTGGGACAGGGTCAGGGTAGG + Intergenic
1017726186 6:157277459-157277481 GAGTGGGACCAGAGGAGAGAAGG - Intergenic
1017972651 6:159326743-159326765 TAGTGGGAAAGGAGGAGAAGAGG + Intergenic
1018044304 6:159952364-159952386 CACTGGTACAGGAGGAGGATGGG - Intergenic
1018713452 6:166514190-166514212 GAGTGGGCCAGGAGAAGAGGTGG - Intronic
1019009715 6:168834283-168834305 CAGTTGGAGAGGAAGAGAGCAGG + Intergenic
1019478495 7:1255398-1255420 CATGGGGACAGGAGGGGAGGGGG + Intergenic
1019631716 7:2053075-2053097 CAGTGGCAGAGCAGGAGGGTAGG - Intronic
1019999153 7:4745087-4745109 CAGCCAGAGAGGAGGAGAGTGGG - Intronic
1020091726 7:5345689-5345711 CACCGGGCCTGGAGGAGAGTGGG - Exonic
1022345983 7:29515168-29515190 AAGTGGGACAGGAGCAGGGTTGG + Intergenic
1022609340 7:31853650-31853672 TATTTGGACAGGAGGAGAGAAGG + Intronic
1022644553 7:32218209-32218231 AAGTGGGAAAGGAACAGAGTGGG - Intronic
1022671870 7:32463256-32463278 CATTGGGCCTGGAGGAGTGTAGG - Intergenic
1023124366 7:36940371-36940393 CAGTGGGACTTAAGGAGAATAGG + Intronic
1024215276 7:47243296-47243318 CAGTGGGGCAGGTGGAGTCTAGG - Intergenic
1025612546 7:63089495-63089517 CAGATAGATAGGAGGAGAGTTGG + Intergenic
1026218197 7:68368252-68368274 CAGTGGGGAAGGAAGAGAGTAGG - Intergenic
1026552768 7:71381969-71381991 CAGAGGGACAGGAGAACTGTGGG + Intronic
1027767699 7:82366063-82366085 GAGTGGTCTAGGAGGAGAGTTGG - Intronic
1027837737 7:83266779-83266801 AAGTGGGGCAGGAGAAGAGGAGG + Intergenic
1029075926 7:97934106-97934128 CAGTCTGACTGGAGGAGAGTGGG + Intergenic
1029200629 7:98836968-98836990 CAGAGGAACAGGAGGAGTTTAGG - Intergenic
1029819520 7:103132433-103132455 TGGTTGGTCAGGAGGAGAGTGGG + Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1030617849 7:111757021-111757043 GAGTTTGCCAGGAGGAGAGTGGG + Intronic
1030946115 7:115722857-115722879 CAGTTGGACAGCAGTAGAGTTGG - Intergenic
1031012188 7:116536148-116536170 CAGTGAGAAAGTAGGAGATTGGG + Intronic
1031096444 7:117426577-117426599 GAGTGGGATAGGATTAGAGTAGG + Intronic
1032456880 7:132079891-132079913 CAGAGGGACAGGAGGAGGGGAGG - Intergenic
1034889733 7:154829405-154829427 GAGGGGGAGAGGAGGAGAGGAGG + Intronic
1035238994 7:157517786-157517808 CTTTGGGGCAGGAAGAGAGTAGG + Intergenic
1036074110 8:5475673-5475695 CAGTGTAACAGGAGGTGGGTAGG - Intergenic
1036306373 8:7605639-7605661 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036357219 8:8053624-8053646 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036901350 8:12671629-12671651 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1037391636 8:18398979-18399001 AAGTGAGACAGGATGAGAGAAGG - Intronic
1037560542 8:20070436-20070458 CAGTGGAACAGGAGTGGAGGGGG - Intergenic
1037704892 8:21310490-21310512 CAGTGGGACAGGACCACACTGGG + Intergenic
1037705033 8:21311089-21311111 CAGTGGGAAAGGACGACACTGGG + Intergenic
1037705044 8:21311133-21311155 CAGTGGGAAAGGATGACACTGGG + Intergenic
1037705112 8:21311396-21311418 CAGTGGGAAAGGATGACACTGGG + Intergenic
1037705136 8:21311483-21311505 CAGTGGGAAAGGACGACACTGGG + Intergenic
1037705259 8:21312004-21312026 CAGTGGGAAAGGACGACACTGGG + Intergenic
1037705605 8:21313382-21313404 CAGTGGGAAAGGACGACACTGGG + Intergenic
1037950679 8:23017192-23017214 CAGAGGGACAAGAGGAACGTGGG - Intronic
1038240156 8:25800699-25800721 CAGAGAGACAGGAGGAGAGCTGG - Intergenic
1038605779 8:29002301-29002323 CAGTGGGAGAGAGGGAGAGAGGG + Intronic
1039837152 8:41265648-41265670 CAGGGGCACAGGTGCAGAGTTGG + Intronic
1041369680 8:57145579-57145601 CAGTGGGACAAGATTAGAGGTGG + Intergenic
1041618325 8:59934433-59934455 CAGTGTGGCAGGAGCATAGTTGG + Intergenic
1041638693 8:60173696-60173718 CACTGGGACGGTAGGACAGTGGG - Intergenic
1041929332 8:63269692-63269714 CAGGGGGATAGGAGGAGGGGAGG + Intergenic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1042868977 8:73380420-73380442 CAGTGAGAGAGGAGGAGATGAGG - Intergenic
1044080016 8:87872326-87872348 CAGTGGGAGAGGAGAGGAGGGGG - Exonic
1045010175 8:97951895-97951917 CTGCGGGAAAGGAGGAGACTAGG + Intronic
1045552713 8:103186867-103186889 CAGTGGGACCTGAGGACATTTGG - Intronic
1046612953 8:116445941-116445963 CAGGGGGACTGGAGGAGGGGTGG - Intergenic
1046860707 8:119088157-119088179 TAGTGGGAAGGAAGGAGAGTGGG + Intronic
1047627217 8:126668433-126668455 CAGTGGGAGAGGAGCCCAGTGGG + Intergenic
1047928602 8:129704416-129704438 CAGAGGGAAGGGAGGAGAGAAGG - Intergenic
1048268116 8:133005277-133005299 CAGGGGGACAGGGGGACAGTGGG + Intronic
1049302621 8:141879672-141879694 GAGAGGGACAGGAGGAGAAGGGG - Intergenic
1049621410 8:143599896-143599918 CAGGGGGAGGGGAGGAGAGATGG - Exonic
1049660701 8:143818596-143818618 GGGTGGGCCAGGAGGGGAGTGGG - Intronic
1049688789 8:143949859-143949881 CACTGGGACAGGAGAGGAGGCGG + Intronic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1049955468 9:688916-688938 CAGTGGGAAAGAAGGAAAGCAGG - Intronic
1051710930 9:19929797-19929819 CAGTGGGACAGATGTAGAGGTGG + Intergenic
1052323155 9:27190166-27190188 CAGTGGGACTGGAGGGTACTAGG + Intronic
1053150285 9:35738904-35738926 CTGTGGGAGAGGAGGGGACTTGG + Intronic
1053272538 9:36760273-36760295 CCCTGGGACAGGGGGAGAGTGGG - Intergenic
1054871961 9:70055387-70055409 CAGTTGGAGAGTGGGAGAGTGGG + Intronic
1054929379 9:70620025-70620047 CAGGGGGAGAGGAGGAAAGGTGG - Intronic
1055128929 9:72752477-72752499 TAGTGGGATGGGATGAGAGTGGG + Intronic
1055249152 9:74281554-74281576 CAGGGAGACAGGATGAGAGAGGG + Intergenic
1056067522 9:82952587-82952609 CTGAGGGATGGGAGGAGAGTAGG + Intergenic
1056338242 9:85599189-85599211 GAGAGGGACAGAAGGAGAGAGGG + Intronic
1056620194 9:88206117-88206139 CAGGAGGAAAGGAGAAGAGTGGG + Intergenic
1056914657 9:90735595-90735617 GATTGGGACAGGAGGAAAGTGGG + Intergenic
1057909112 9:99004467-99004489 CACTGGGCTAGGAAGAGAGTGGG + Intronic
1057987751 9:99734436-99734458 CAGAGTAGCAGGAGGAGAGTGGG + Intergenic
1058178843 9:101771206-101771228 CAGTGTGTCAGAAGGGGAGTAGG - Intergenic
1058434555 9:104950359-104950381 CAGTGGGACAAGATGTGAGGTGG - Intergenic
1058886138 9:109322450-109322472 CGGTGGGAGAGGAGTAGATTGGG - Intergenic
1059106933 9:111520225-111520247 AAGTTTGACAGGAGGACAGTGGG - Intergenic
1059165869 9:112075993-112076015 TAATGGGAAAGGAGGAGAGCAGG + Intronic
1059335227 9:113564883-113564905 CACTGGGACAGGAACAGCGTCGG + Intronic
1059446717 9:114342599-114342621 AAAGGGAACAGGAGGAGAGTGGG + Intronic
1059819450 9:117956069-117956091 CAGTGGGGCAGGAGAATAGGGGG + Intergenic
1060822326 9:126668798-126668820 TAGGGGGACAAGAGGTGAGTGGG - Intronic
1061485134 9:130916701-130916723 CAGTGGGATGGGAGGACAGAGGG + Intronic
1061509482 9:131051798-131051820 CACTGGGAAAGGAGGAGGGAGGG + Intronic
1061809328 9:133153352-133153374 CAGTGAGACAGGGGGAGGGGAGG - Exonic
1062120554 9:134831813-134831835 CTGTGGAACAGGACGAGAGGTGG - Intronic
1062328768 9:136026460-136026482 CAGAAGGAGAGGAGGAGAGGAGG + Intronic
1062566295 9:137165398-137165420 CAGGGAGACAGGGGCAGAGTGGG - Intronic
1185645209 X:1610838-1610860 CAGAGGGAGAGGAGGGGAGGGGG - Intergenic
1186665646 X:11714185-11714207 CTGTTGTTCAGGAGGAGAGTTGG + Intergenic
1187014022 X:15308302-15308324 CAGAGGCACAGGATCAGAGTTGG - Intronic
1187032586 X:15503197-15503219 CAGTGGTACAGAAGGGGAGCAGG - Intronic
1188019805 X:25144737-25144759 CAGCGAGACAGGAGGAGGGTGGG + Intergenic
1188741651 X:33790751-33790773 CCCTGGGACAGGAGGGGAGTTGG - Intergenic
1189322831 X:40096932-40096954 CGGTGGGCCAGGAGGAGAGCAGG - Intronic
1192146636 X:68686996-68687018 TAGTGGGACAGGAAGACAGGAGG - Intronic
1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG + Intergenic
1193584968 X:83310583-83310605 CACTGGGATAGGGAGAGAGTAGG + Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1195010299 X:100727045-100727067 CAGTGCAGCAGGAGGAGAGAAGG - Intronic
1195750334 X:108157545-108157567 CAGTGGGACAGTAGCAGTTTGGG - Intronic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1195985240 X:110622123-110622145 CAGTGGGAAAGGGGGATCGTTGG - Intergenic
1196743294 X:119044661-119044683 CAGTTGCAGAGGAGCAGAGTGGG - Intergenic
1197183973 X:123565841-123565863 AAGTGGGACAGAAGGAGAGGAGG + Intergenic
1197753932 X:129982341-129982363 CACTGGGAGGGGAGGAGAGGAGG - Intronic
1198599826 X:138270343-138270365 CAGTGAGAACGGAGGAAAGTAGG - Intergenic
1198974444 X:142319913-142319935 CAGTGGGACAGGAAGCCAATTGG - Intergenic
1199516695 X:148685228-148685250 CACTGGGACAGGAGGAAAAGGGG + Intronic
1200091672 X:153638897-153638919 CAGGGGAAGAGGAGGAGAGAGGG - Intergenic
1200886585 Y:8278099-8278121 CAGTGTGACAGGGGGAAGGTGGG - Intergenic
1201558872 Y:15293486-15293508 CAGTGGGTCAGGAGCAGTGGGGG + Intergenic