ID: 915704857

View in Genome Browser
Species Human (GRCh38)
Location 1:157833940-157833962
Sequence GAGAGTTTCAAATGTGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 333}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915704857 Original CRISPR GAGAGTTTCAAATGTGCTGA TGG (reversed) Intronic
901395338 1:8977006-8977028 GAGAGTGTGGCATGTGCTGATGG + Intergenic
901775460 1:11557479-11557501 GAGATTGGCAAAAGTGCTGAAGG - Intergenic
905682217 1:39882242-39882264 GATCGTTTCATGTGTGCTGATGG + Intronic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
906576884 1:46899096-46899118 GACAGGTTCACATCTGCTGACGG + Intergenic
907185219 1:52603767-52603789 GTGAGTTTCAAATCAGATGAAGG + Intronic
907527840 1:55064032-55064054 GTGAGTGTGAAAGGTGCTGATGG + Exonic
907921663 1:58919647-58919669 GAGAGTCTCAAGTTTGCTGTAGG - Intergenic
907940747 1:59084642-59084664 GGCAGTTTCAAGTGTGCAGAAGG - Intergenic
908508621 1:64831447-64831469 GCAAGTACCAAATGTGCTGATGG + Exonic
909474570 1:76068327-76068349 GAGAATATCATATGTGATGAAGG + Intergenic
910457858 1:87417070-87417092 GAAATTTTCAACTGTGTTGAGGG - Intergenic
912161679 1:106993206-106993228 TAGAGTTTTAAATGTACAGATGG + Intergenic
913797235 1:122637786-122637808 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913804783 1:122774624-122774646 GAGTGTTTCCAAACTGCTGAAGG - Intergenic
913805167 1:122781427-122781449 GAGTGTTTCCAAACTGCTGAAGG - Intergenic
913807489 1:122822907-122822929 GAGTGTTTCCAAACTGCTGAAGG - Intergenic
913807560 1:122824096-122824118 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913809813 1:122864899-122864921 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913811304 1:122891584-122891606 GAGTGTTTCCAAACTGCTGAAGG - Intergenic
913812391 1:122910791-122910813 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913813927 1:122938675-122938697 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913815412 1:122965192-122965214 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913827185 1:123175411-123175433 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913827300 1:123177449-123177471 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913827418 1:123179492-123179514 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913828366 1:123196834-123196856 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913830150 1:123229091-123229113 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913830480 1:123235206-123235228 GAGAGTTTCAAATCTGCTCTGGG - Intergenic
913832985 1:123279897-123279919 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913833791 1:123294340-123294362 GAGTGTTTCCAAACTGCTGAAGG - Intergenic
913835557 1:123325618-123325640 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913842368 1:123447106-123447128 GAGTGTTTCCAAACTGCTGAAGG - Intergenic
913845410 1:123502164-123502186 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913846156 1:123515593-123515615 GAGTGTTTCCAAACTGCTGAAGG - Intergenic
913847833 1:123546016-123546038 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913848002 1:123549066-123549088 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913848059 1:123550087-123550109 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913853229 1:123642878-123642900 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913854328 1:123662597-123662619 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913854444 1:123664636-123664658 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913855805 1:123689455-123689477 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913858650 1:123740774-123740796 GAGTGTTTCCAAACTGCTGAAGG - Intergenic
913859268 1:123751819-123751841 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913862036 1:123800606-123800628 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913862658 1:123811814-123811836 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913862881 1:123815892-123815914 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913869391 1:123932968-123932990 GAGTGTTTCCAAACTGCTGAAGG - Intergenic
913869916 1:123942484-123942506 GAGTGTTTCCAAACTGCTGAAGG - Intergenic
913870825 1:123958628-123958650 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913871120 1:123963726-123963748 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913874643 1:124027620-124027642 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913876539 1:124061284-124061306 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913876893 1:124067402-124067424 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913879281 1:124109503-124109525 GAGGGTTTCAAATCTGCTCTGGG - Intergenic
913882673 1:124170956-124170978 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913883159 1:124179793-124179815 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913885811 1:124226705-124226727 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913888248 1:124270363-124270385 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913889784 1:124297902-124297924 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913895866 1:124407045-124407067 GAGTGTTTCCAAACTGCTGAAGG - Intergenic
913898195 1:124448680-124448702 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913898762 1:124458877-124458899 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913899397 1:124470094-124470116 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913903485 1:124543827-124543849 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913913902 1:124730442-124730464 GAGTGTTTCAAATCTGCTCTGGG - Intergenic
913916826 1:124782945-124782967 GAGTGTTTCCAAACTGCTGAAGG - Intergenic
915704857 1:157833940-157833962 GAGAGTTTCAAATGTGCTGATGG - Intronic
916375170 1:164145899-164145921 GTGAGTTTCAGATTTACTGACGG - Intergenic
916393960 1:164365257-164365279 GAGAGGTTAAGTTGTGCTGAAGG + Intergenic
917233639 1:172865603-172865625 AAAAGTTTTAAATGTGGTGAAGG - Intergenic
917882069 1:179346923-179346945 TAGAATTTCAAATGTCCTGTGGG + Intronic
919030464 1:192235662-192235684 GAGAGTCTCAAATGTGAGTAGGG + Intergenic
920410376 1:205755047-205755069 GGGAGTTTGAAATTTGCTAAAGG - Intergenic
922120558 1:222663448-222663470 GAGAGTATTAGATTTGCTGATGG - Intronic
1064675790 10:17759015-17759037 GAGAGCTTAAAATGTACTGGAGG + Intronic
1066823988 10:39539180-39539202 GAGTGTTTCAAAACTGCTGTAGG - Intergenic
1066824140 10:39542408-39542430 GAGTGTTTCAAAAGTGCTGTAGG - Intergenic
1066824403 10:39547857-39547879 GAGTGTTTCAAAACTGCTGTAGG - Intergenic
1067405023 10:46014453-46014475 GAGAGACCCAAATGTGGTGATGG + Exonic
1068913153 10:62400262-62400284 GAGGCTTTCAAATTAGCTGAGGG - Intronic
1070639574 10:78158109-78158131 GAGACTTTCACCTGTGCTGGCGG - Intergenic
1073002024 10:100293006-100293028 GAGGGTTTCGGATGTGCAGAAGG - Exonic
1073692555 10:105826391-105826413 GAGATTTTTAAATTTGCTGATGG + Intergenic
1073956315 10:108875417-108875439 GAGAATTTAAGATTTGCTGAGGG - Intergenic
1074993101 10:118729294-118729316 GAGAGTCTCAAAGGAGCTGCAGG - Exonic
1077455686 11:2678460-2678482 GAGAGTTTGAAATATGATAAAGG - Intronic
1077997802 11:7468955-7468977 CAGAGTTGCAAATGGGCTGAGGG - Exonic
1080733053 11:34980583-34980605 AAGAATTTCAAATCTTCTGAGGG + Intronic
1080846599 11:36032431-36032453 GAGATTTTAAAATGCACTGATGG - Intronic
1082584626 11:54920527-54920549 GAAAGGTTTAAATGTGCTGCAGG + Intergenic
1085402924 11:76245300-76245322 GTGAGGTTCAAATGAGCTAATGG + Intergenic
1091463215 12:661643-661665 GCAAGTTTCTTATGTGCTGATGG - Intronic
1094005004 12:25740007-25740029 TAGAGTTTGAAATGTACTAAGGG + Intergenic
1094858927 12:34437059-34437081 CAGTGTTTCCAATCTGCTGAAGG + Intergenic
1094867543 12:34555333-34555355 TAGAGTTTCCAAACTGCTGAAGG + Intergenic
1095034831 12:37349612-37349634 GAAAGTTTCAAATCTGCTCGAGG + Intergenic
1098800538 12:74951835-74951857 GGGGGTTTCAAATCTGCTGTGGG - Intergenic
1099208648 12:79758279-79758301 GTGATTTTCAGATGTGCTGCTGG + Intergenic
1099645899 12:85356012-85356034 GAGAGTTTACATTGTGCTCATGG - Intergenic
1099806107 12:87521240-87521262 GATATTTTCAAATGTCCTTATGG - Intergenic
1100217469 12:92467143-92467165 GACAGTTTCAGATGGGCAGATGG - Intergenic
1101630767 12:106491982-106492004 GATTGTTTCAATTTTGCTGATGG - Intronic
1103317318 12:120066721-120066743 GAGAGTTTCACATGAACTGAAGG - Intronic
1103882047 12:124173622-124173644 GCCAGTTTCAAAAGTGCTGTGGG + Intronic
1104399940 12:128466903-128466925 TAAAGCTGCAAATGTGCTGAGGG + Intronic
1105103604 13:16495610-16495632 GAGCGTTTCAAACCTGCTGTAGG - Intergenic
1105106569 13:16544046-16544068 GAGTGTTTCAAAACTGCTGTAGG - Intergenic
1105107583 13:16560426-16560448 GAGTGTTTCAAAACTGCTGTAGG - Intergenic
1105108186 13:16569981-16570003 GAGTGTTTCAAAACTGCTGTAGG - Intergenic
1105113727 13:16661216-16661238 GAGTGTTTCAAAACTGCTGTAGG - Intergenic
1105127482 13:16885324-16885346 GAGCGTTTCAAACCTGCTGTAGG - Intergenic
1105132057 13:16960361-16960383 GAGCGTTTCAAATTTGCTCTAGG - Intergenic
1105154530 13:17327407-17327429 GAGTGTTTCAAAACTGCTGTGGG - Intergenic
1105155298 13:17339695-17339717 GAGTGTTTCAAAACTGCTGTAGG - Intergenic
1105158280 13:17388148-17388170 GAGCGTTTCAAATTTGCTCTAGG - Intergenic
1105172571 13:17614821-17614843 GAGTGTTTCAAACGTGCTCTAGG - Intergenic
1106846837 13:33745873-33745895 GAGTGTTTCAAAGATGCTGATGG + Intergenic
1107419013 13:40228763-40228785 GAGACTTTCAGATGTGCACAAGG + Intergenic
1108859250 13:54833511-54833533 GAAAGTTTTAAAAGTGTTGAGGG + Intergenic
1109773847 13:67013964-67013986 CAGAGTTTGAAATAGGCTGAGGG - Intronic
1110697779 13:78511902-78511924 GAGAGTTTCAAATGTGCCACAGG + Intergenic
1112209304 13:97359420-97359442 GAGAGTTAAACATGTGCTGGAGG - Intronic
1112479132 13:99757840-99757862 GGAATTTTCAAATATGCTGATGG - Intronic
1115516328 14:34188862-34188884 AGGAGTTTCCAGTGTGCTGAGGG - Intronic
1118449075 14:65880915-65880937 GAGAGACACAAATGTGGTGATGG + Intergenic
1119084255 14:71725407-71725429 GAGAGTTTGGAAAGTTCTGAAGG - Intronic
1121973097 14:98377236-98377258 GAGAGCTTCAGATGTCTTGATGG - Intergenic
1122127370 14:99586566-99586588 GAGTGTTGTAAATGTGCAGATGG - Intronic
1124424775 15:29554625-29554647 GATAGTATTAAGTGTGCTGAAGG + Intronic
1125252117 15:37716579-37716601 GAGCGTTTCAAATGTGCATAAGG + Intergenic
1126523526 15:49623371-49623393 GAGAGTTGCAAATGCTCTGTTGG - Intronic
1127991284 15:64119879-64119901 GAGAGTTTCAAACTTCTTGAGGG - Intronic
1128992927 15:72275399-72275421 GAGAGATTCAAATGTTTGGAGGG - Intronic
1129140127 15:73590312-73590334 GAGAGCTTCAAATAAGCTGAGGG + Intronic
1129786022 15:78310669-78310691 GAGAGTCTCAAAGGGGCAGAAGG + Intergenic
1130239190 15:82169885-82169907 CAGAGTTTAAAATCTGGTGAGGG + Intronic
1133476848 16:6131801-6131823 GAGAGGCTCACATGTGCTGCTGG + Intronic
1133488357 16:6242558-6242580 GAGAGTTGCATAAGTGATGATGG - Intronic
1133662762 16:7934924-7934946 GTGAGTTTCAAAAGGGATGAAGG - Intergenic
1137077976 16:35999715-35999737 GAGAGATTCAAAAATGCTCAAGG - Intergenic
1138482257 16:57311308-57311330 GAAAGTTTCCAAGTTGCTGAAGG + Intergenic
1140920183 16:79530285-79530307 GAGTGGTTCAAATGGGCTGGGGG + Intergenic
1141889846 16:86919253-86919275 GAGAGCTTCCAATTTCCTGACGG + Intergenic
1142737116 17:1908097-1908119 AAATGTTTCAAATGTGCTCAGGG + Intergenic
1144628881 17:16859893-16859915 GACACTTGCAAATGTGCTGATGG + Intergenic
1144652530 17:17016222-17016244 GACACTTGCAAATGTGCTGATGG - Intergenic
1144853801 17:18257427-18257449 GTGAGTTGCCAGTGTGCTGATGG - Intronic
1145160449 17:20570460-20570482 GACACTTGCAAATGTGCTGATGG + Intergenic
1145684835 17:26641781-26641803 GAGTGTTTCAAAACTGCTGTAGG - Intergenic
1149030090 17:52072800-52072822 GAGAGATTGAAGTTTGCTGAGGG + Intronic
1152002871 17:77657491-77657513 GGGAGGTTCAAGTGTGCAGAAGG + Intergenic
1154063444 18:11084723-11084745 GAGAAGTTCTAATGTGCTGGTGG - Intronic
1154540954 18:15535173-15535195 GAGAGTTTCAAACCTGCCTATGG + Intergenic
1154542350 18:15555326-15555348 GAGTGTTTCAAACGTGCTTTAGG - Intergenic
1154906053 18:20573189-20573211 GAGAGTTTCAAACCTGCCTATGG + Intergenic
1154909361 18:20624952-20624974 GAGAGTTTCAAACCTGCCTATGG + Intergenic
1154913336 18:20687583-20687605 GAGAGTTTCAAACCTGCCTATGG - Intergenic
1156421405 18:36957349-36957371 GAGATTTGAAAATGTACTGAAGG + Intronic
1157467300 18:47958275-47958297 GAGAGTATCACATGTGTAGAAGG - Intergenic
1160211187 18:76881391-76881413 CAGCGTTTCAAATGAGCAGACGG + Exonic
1160468891 18:79108508-79108530 TATTGTTTCAAAAGTGCTGATGG + Intronic
1167733961 19:51279935-51279957 GGGAGTTCCAAATGAGCTAATGG + Intergenic
926414704 2:12637869-12637891 GAGAGTTTCAAAGATACTCAAGG - Intergenic
927383493 2:22506387-22506409 GAGACTTTTAGATGTGCTCATGG + Intergenic
930287104 2:49444180-49444202 GAGAGCTGTAAATGTGCAGATGG + Intergenic
931466782 2:62495757-62495779 GATTGTTTAAAATGTGCTGAAGG - Intergenic
931827042 2:66011783-66011805 GAGATTTTAAAACTTGCTGAAGG - Intergenic
935037905 2:99396796-99396818 GAGAATTAAAAATGTACTGAGGG - Exonic
937346745 2:121130654-121130676 GAGGGTCCCAAATGTGCAGATGG - Intergenic
940389345 2:153113493-153113515 TGGAGTTTCATATGTGCTTAGGG + Intergenic
941156918 2:161990360-161990382 GAGAGTTTTAAATTAGCTTATGG - Intergenic
944788305 2:203096769-203096791 CAGAGTCTCAAATATGCTAATGG - Intronic
947433058 2:230047270-230047292 AAGAGTTTCTAATGTACTCAGGG + Intronic
1169282232 20:4277771-4277793 GAAACTTTCAAATGTTTTGAAGG - Intergenic
1170423950 20:16219564-16219586 GAGTCTTTCAAGTGTGCTAATGG - Intergenic
1171109183 20:22464795-22464817 GACAGATTCAAATGTACTGAAGG + Intergenic
1171728325 20:28649362-28649384 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171728435 20:28651401-28651423 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171728553 20:28653497-28653519 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171728665 20:28655495-28655517 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171728766 20:28657368-28657390 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171728865 20:28659240-28659262 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171728967 20:28661112-28661134 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171729068 20:28662984-28663006 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171729170 20:28664857-28664879 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171729269 20:28666729-28666751 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171729371 20:28668601-28668623 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171729473 20:28670475-28670497 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171729573 20:28672349-28672371 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171729675 20:28674221-28674243 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171729774 20:28676093-28676115 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171729977 20:28679838-28679860 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171730094 20:28681943-28681965 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171730194 20:28683815-28683837 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171730296 20:28685687-28685709 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171730398 20:28687560-28687582 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171730527 20:28689699-28689721 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171730628 20:28691571-28691593 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171730729 20:28693444-28693466 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171730905 20:28696628-28696650 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171731033 20:28698772-28698794 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171731132 20:28700644-28700666 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171731235 20:28702516-28702538 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171731442 20:28706435-28706457 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171731543 20:28708307-28708329 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171731644 20:28710179-28710201 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171731747 20:28712051-28712073 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171731947 20:28715800-28715822 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171732281 20:28721952-28721974 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171744903 20:28961058-28961080 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171745002 20:28962930-28962952 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171745101 20:28964802-28964824 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171745200 20:28966674-28966696 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171745299 20:28968546-28968568 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171745350 20:28969567-28969589 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171745450 20:28971439-28971461 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171745550 20:28973311-28973333 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171745649 20:28975183-28975205 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171745748 20:28977055-28977077 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171745847 20:28978927-28978949 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171745946 20:28980799-28980821 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171746045 20:28982671-28982693 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171746145 20:28984543-28984565 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171746244 20:28986415-28986437 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171746344 20:28988287-28988309 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171746443 20:28990159-28990181 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171746542 20:28992031-28992053 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171746642 20:28993903-28993925 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171746742 20:28995775-28995797 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171746842 20:28997647-28997669 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171746942 20:28999519-28999541 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171747043 20:29001391-29001413 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171747143 20:29003263-29003285 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171747242 20:29005135-29005157 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171747342 20:29007007-29007029 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171747442 20:29008879-29008901 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171747542 20:29010751-29010773 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171747642 20:29012623-29012645 GAGTGTATCAAATCTGCTCAAGG - Intergenic
1171799078 20:29593569-29593591 AAGAGTTTCCAACCTGCTGAAGG - Intergenic
1171844971 20:30262899-30262921 AAGAGTTTCCAACCTGCTGAAGG + Intergenic
1172246726 20:33450522-33450544 AAGAGTTTCATATGGGCTGGGGG + Intergenic
1173447070 20:43128727-43128749 TTGTCTTTCAAATGTGCTGAAGG - Intronic
1174184872 20:48699352-48699374 GAGAATTTGAAAAGTGCTGCAGG + Intronic
1180508390 22:16044169-16044191 GAGAGATTCAAAACTGCTCAAGG + Intergenic
1183244194 22:36680908-36680930 GAGTTTTTCAGATGTGCTGCTGG - Intronic
949269677 3:2200243-2200265 TAGAGTTAAAGATGTGCTGATGG + Intronic
950284765 3:11735932-11735954 GAGAGATTCAAATGGGGTTAGGG + Intergenic
952559900 3:34579515-34579537 GAAAGTTTCTAATATGCTCAGGG + Intergenic
953472169 3:43176925-43176947 GAGTGTTTCACATGTGCTATGGG + Intergenic
954777834 3:53035921-53035943 GAGACTGTCAAAAATGCTGAAGG - Intronic
955775197 3:62425356-62425378 GACATTTCCAAATGTGCTGTAGG + Intronic
956164889 3:66389857-66389879 GAGAGTTTCAAACTTGATGGAGG - Intronic
957265195 3:77954559-77954581 GACATTTTCAATTTTGCTGATGG + Intergenic
958827112 3:99043643-99043665 GAGAATGTTCAATGTGCTGATGG - Intergenic
958983730 3:100755816-100755838 GAGAGTTTCAGATTTGCTCAAGG + Intronic
959154066 3:102644841-102644863 GGGAGATCCAAATGTCCTGAAGG - Intergenic
960528076 3:118733148-118733170 CAGATTTACATATGTGCTGATGG + Intergenic
961103080 3:124218387-124218409 GAGAGTTACAAAGGCGCCGAGGG - Intronic
963542653 3:146613332-146613354 GAACACTTCAAATGTGCTGATGG - Intergenic
964573486 3:158138349-158138371 GAGACTTTCATATGTGCTTTTGG + Intronic
964677003 3:159294664-159294686 GAGACTTTAAAATGTTTTGAAGG - Intronic
966236836 3:177711112-177711134 GAGCTATTCAAATGAGCTGAAGG + Intergenic
971568146 4:28171882-28171904 AAGACTTTCAAATGAGCTGATGG + Intergenic
972445530 4:39139865-39139887 GGAACTTTCAAATGTGCTAAGGG + Intergenic
973706527 4:53586431-53586453 GAGAGTTTCGACTCTGCTGCTGG + Intronic
975436438 4:74357968-74357990 GAAAGTTTCAATTTTTCTGATGG - Intergenic
976782038 4:88771410-88771432 TAGACCTTCAAATGTGCTGTAGG + Intronic
979295951 4:119032422-119032444 GAAAGGTTCAAATGTAGTGAAGG + Intronic
980082446 4:128358290-128358312 GAGGATTACAGATGTGCTGAAGG + Intergenic
984162518 4:176271204-176271226 GAGAGGGTGAAATTTGCTGAGGG - Intronic
984691982 4:182736832-182736854 GAGAGTTTCAAATCTGTTCCTGG - Exonic
984864883 4:184272892-184272914 GCGAGTATTAAATGTGATGATGG - Intergenic
985934665 5:3087655-3087677 CAGAGTTTCAATTTTGCTGAAGG + Intergenic
987103412 5:14613290-14613312 GAGATTTTAAAAAGTTCTGAGGG - Intronic
989376564 5:40769372-40769394 GACAATTTCAAATGTATTGAGGG + Intronic
994314425 5:98316009-98316031 GATAGTAACATATGTGCTGAGGG - Intergenic
994991744 5:107005352-107005374 GAGAGTTTGTAATGTGCTTGAGG - Intergenic
995191427 5:109322666-109322688 GGGAGTTACAAATGTGGAGAGGG - Intergenic
996945689 5:129064604-129064626 ACTATTTTCAAATGTGCTGATGG + Intergenic
997247135 5:132359287-132359309 GAGAGTAACAAGTGGGCTGAGGG + Intergenic
997500200 5:134367771-134367793 TAGAGTTTGACATGTGGTGAGGG - Intronic
997783260 5:136681541-136681563 GAGAAATGCAAATGTGGTGATGG - Intergenic
998110089 5:139494703-139494725 GAGAGACCCAAATGTGGTGATGG - Intergenic
999531948 5:152473332-152473354 GAGAGCTTCAAATGTGCTGAAGG + Intergenic
1000960253 5:167592504-167592526 GATGGTTTTAAATATGCTGAAGG - Intronic
1003002409 6:2348418-2348440 GAGCGTTACAGAGGTGCTGAGGG + Intergenic
1005438745 6:25842204-25842226 CAGAATTTGAAATGTGATGAAGG + Intronic
1007934908 6:45724243-45724265 GGGAGTTTCATCTGTGTTGATGG - Intergenic
1009250722 6:61294303-61294325 GAGTGTTTCCAAACTGCTGATGG + Intergenic
1011844432 6:91545884-91545906 GATAGTTGCAACTGTGCTTAGGG + Intergenic
1012394410 6:98779652-98779674 GAGGGTTTTAATTGTGATGATGG + Intergenic
1012827896 6:104168914-104168936 GACATTGTCAAATCTGCTGAGGG + Intergenic
1013229101 6:108145264-108145286 GAAAGATTCAAATGTCTTGAAGG + Intronic
1013645845 6:112140312-112140334 GAGAGTATGAAATCTGATGAAGG - Intronic
1014968439 6:127784517-127784539 GAGAGGATTTAATGTGCTGATGG - Intronic
1016268967 6:142266212-142266234 GATTGTTACTAATGTGCTGATGG + Intergenic
1016280259 6:142409123-142409145 GAGAGTTTCAACTGGGGAGATGG - Intronic
1017466177 6:154695981-154696003 AAGATTTTCAAATTTGCTGTTGG - Intergenic
1018584000 6:165335642-165335664 GAGAGCTGCATCTGTGCTGAAGG - Intronic
1019181712 6:170191371-170191393 GAGATTCTCAAACGTGCTGTGGG + Intergenic
1019181809 6:170192055-170192077 GAGATTCTCAAACGTGCTGTGGG + Intergenic
1019181818 6:170192131-170192153 GAGATTCTCAAACGTGCTGTGGG + Intergenic
1024835427 7:53512754-53512776 GAAAGATTAAAAAGTGCTGAAGG - Intergenic
1025250650 7:57349176-57349198 GAGCTTCTCAAATGTGCTGCTGG + Intergenic
1025575354 7:62632626-62632648 AACAGTTTCAAAACTGCTGAAGG + Intergenic
1025589888 7:62844550-62844572 TAGTGTTTCAAAACTGCTGAAGG - Intergenic
1026439792 7:70434175-70434197 GAGATTCTGAAATCTGCTGAGGG - Intronic
1032900875 7:136305912-136305934 GAGAGTTGCATCTGTGCTCAGGG + Intergenic
1033667978 7:143461550-143461572 GTGAGAATAAAATGTGCTGATGG + Intergenic
1034070990 7:148184868-148184890 GTGAGGATCAAATGAGCTGATGG + Intronic
1037302778 8:17470161-17470183 GAATATTTCAAATGTGCAGAAGG + Intergenic
1038721067 8:30035800-30035822 GAGAGTGTTAAATGTTGTGAGGG - Intergenic
1039232211 8:35460831-35460853 GAGCTTTCTAAATGTGCTGAAGG - Intronic
1042126672 8:65544862-65544884 GAGAGTTTGAAGACTGCTGAAGG - Intergenic
1042381629 8:68121646-68121668 GAGAGTTTCAAAAATGATTATGG + Intronic
1042491217 8:69400473-69400495 GTGATTTTAAAATTTGCTGAAGG + Intergenic
1043125033 8:76382368-76382390 GAGATTTTAAAATGTGCTCCTGG + Intergenic
1044356415 8:91227816-91227838 GAGAGTTTCAAATGTTATTCTGG - Intronic
1045919939 8:107517933-107517955 GAGAGATTCAAGTGTGCTGTTGG - Intergenic
1046279578 8:112008331-112008353 GAGAGTTTTAACTGTTTTGATGG - Intergenic
1046351998 8:113026971-113026993 TACAGTTTGAAATGTGCTTATGG - Intronic
1047532407 8:125688892-125688914 GAGGGGTTCACATGTGGTGAGGG + Intergenic
1048030665 8:130628541-130628563 GAGAGTTGGAAATGTGGTAAAGG - Intergenic
1050097230 9:2079170-2079192 CAGAGTCCCAAGTGTGCTGACGG - Intronic
1051585468 9:18722373-18722395 CAGACTTTCAAATCTGCTGATGG + Intronic
1052143258 9:25015566-25015588 GAGGGTGTCAGATGTGATGACGG + Intergenic
1052480150 9:29013963-29013985 AAGAATGTCAAATGTGCAGAAGG - Intergenic
1052710156 9:32044347-32044369 GAGAGTTATAAATGTGTTTAGGG + Intergenic
1054702593 9:68428285-68428307 GCGAGTTTCAAATGTCCCCAGGG + Intronic
1055713854 9:79095636-79095658 GAAAGTTTCAAAGGTGCCAAAGG - Intergenic
1059357094 9:113708366-113708388 GAAAGTTTCCCATATGCTGAGGG - Intergenic
1059585404 9:115600797-115600819 GAGAGTGTGAAATGTGGAGAAGG + Intergenic
1059851946 9:118351763-118351785 GAGAGGCTCAAATGTCCTAAAGG - Intergenic
1061334902 9:129926571-129926593 GATAATGTCAAAAGTGCTGAAGG + Intronic
1185458661 X:323394-323416 GAGAGCTTCGAAGGTGCTGGGGG + Intergenic
1185819089 X:3184563-3184585 GAGAGTTTAAAAAGTGCTGGAGG + Intergenic
1186290503 X:8092414-8092436 GCAACTCTCAAATGTGCTGATGG + Intergenic
1186290714 X:8095007-8095029 AAGAGTTTCCAAAGTGCTGGAGG + Intergenic
1186713830 X:12229491-12229513 AAGAATTTCAAATGTGCAGAAGG - Intronic
1187106897 X:16252652-16252674 GAGAGATTTAAATGAGATGATGG + Intergenic
1188536781 X:31205235-31205257 TAGAGTTTAAAGTGTGCTTATGG - Intronic
1190203466 X:48383224-48383246 GAGAGTTCAAAATCTCCTGATGG + Intergenic
1190207070 X:48412180-48412202 GAGAGTTCAAAATCTCCTGATGG - Intergenic
1190661122 X:52655082-52655104 GAGAGTTCAAAATCTCCTGACGG - Intronic
1193207759 X:78768845-78768867 AAGAGTTTCAAATATGTTCAAGG - Intergenic
1193589746 X:83374503-83374525 GAGAGAATCAAATGAGGTGAAGG + Intergenic
1193692817 X:84668177-84668199 CATAGCTTGAAATGTGCTGATGG - Intergenic
1193887789 X:87005422-87005444 GAAATCTTCAAATGTGCTAATGG + Intergenic
1194340525 X:92700007-92700029 GAGAGGTGACAATGTGCTGACGG - Intergenic
1195464398 X:105164304-105164326 GAGAGTGACCAATGTGTTGAGGG + Intronic
1195937501 X:110139715-110139737 GAGAGTTGGGAATGTACTGAAGG + Intronic
1198200931 X:134418041-134418063 GAGTATTTAAAATGTTCTGAAGG + Intronic
1198541664 X:137646378-137646400 GACAGCTCCACATGTGCTGATGG - Intergenic
1200648881 Y:5816743-5816765 GAGAGGTGACAATGTGCTGATGG - Intergenic
1201261250 Y:12160979-12161001 GAGATTTTAAAAAGTGCTGGAGG - Intergenic