ID: 915710043

View in Genome Browser
Species Human (GRCh38)
Location 1:157887522-157887544
Sequence TTGAATAAGAATGATTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1759
Summary {0: 1, 1: 0, 2: 6, 3: 147, 4: 1605}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915710043_915710048 29 Left 915710043 1:157887522-157887544 CCACCCTAATCATTCTTATTCAA 0: 1
1: 0
2: 6
3: 147
4: 1605
Right 915710048 1:157887574-157887596 AGGCAAAAACCAAAAAGACTTGG 0: 1
1: 0
2: 2
3: 41
4: 551
915710043_915710047 9 Left 915710043 1:157887522-157887544 CCACCCTAATCATTCTTATTCAA 0: 1
1: 0
2: 6
3: 147
4: 1605
Right 915710047 1:157887554-157887576 AAATTTTAACTACTGCAATAAGG 0: 1
1: 0
2: 6
3: 43
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915710043 Original CRISPR TTGAATAAGAATGATTAGGG TGG (reversed) Intronic
901531304 1:9854512-9854534 TTGAATAAGAATGGTGAAAGCGG - Intronic
901732013 1:11286848-11286870 TTGGATAGGAATCAGTAGGGTGG + Exonic
903388609 1:22946775-22946797 TTGAATAAGAATGGTGAGAGTGG - Intergenic
904574679 1:31497251-31497273 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
905547374 1:38810527-38810549 ATGAATAAGTAGGATTTGGGTGG - Intergenic
905577437 1:39056703-39056725 TTGAATAAGATTGGTGAGAGTGG - Intergenic
906758459 1:48346428-48346450 TTGAATAAGAGTGATGAGAGAGG - Intronic
906881644 1:49598054-49598076 TTGAATAAGAGTGGTTAGAGAGG + Intronic
906897245 1:49788879-49788901 TTGAATAAGAGTGGTGAGAGAGG + Intronic
907356589 1:53879994-53880016 TTGAATAGGAGTGATAAGAGAGG - Intronic
907532378 1:55113864-55113886 TTAAATAAGAGTGATGAGAGAGG - Intronic
907648777 1:56272785-56272807 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
907696234 1:56731938-56731960 TTGAATAAGAATGGAGAGAGTGG - Intronic
907958495 1:59254903-59254925 TTGAATAGGAATGGTGAGAGAGG - Intergenic
908619857 1:65966001-65966023 TTGAATAAGAGTGGTGAGAGAGG - Intronic
908637720 1:66186871-66186893 TTGAATAGGAGTGATGAGAGAGG + Intronic
908818899 1:68062288-68062310 TTGAATAAGAATGGTAAGAAAGG - Intergenic
908937302 1:69391486-69391508 GTGAATAGGAATGGTGAGGGGGG + Intergenic
908939746 1:69417344-69417366 TTGAATAGGAATGGTGAGAGAGG + Intergenic
909053710 1:70797985-70798007 TTGAACAAGAATGGTGAGAGAGG + Intergenic
909287137 1:73834245-73834267 CTGAATAAGAAGGATTTGGTAGG + Intergenic
909485362 1:76167036-76167058 TTGAATAAGAGTGGTGAGAGAGG + Intronic
909492818 1:76244485-76244507 TTGAATAGGAATGATGAGAGAGG + Intronic
909689772 1:78394280-78394302 TTGAATAGGAATGGTGAGAGAGG + Intronic
909869401 1:80720314-80720336 TTGAATAAGAGTGGTGAGAGTGG + Intergenic
909890720 1:81002959-81002981 TTAAATTAGTATGATTAGGTTGG + Intergenic
910096561 1:83529210-83529232 TTGAATAAGAGTGACAAGAGAGG + Intergenic
910190812 1:84593441-84593463 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
910291908 1:85607561-85607583 TTGAATAAGAATGACTAAAGGGG - Intergenic
910299185 1:85686255-85686277 TTTAAAAAGAATGTTAAGGGTGG - Intronic
910353918 1:86332917-86332939 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
910358486 1:86390786-86390808 TTGAATACAAATGATGAGAGTGG - Intronic
910620385 1:89247252-89247274 TTGAATAAGAGTGATGAGCGTGG - Intergenic
910736349 1:90462120-90462142 TTGAATAGGAGTGATGAGAGAGG - Intergenic
910972992 1:92875356-92875378 TTGAATAGTAATGATTTGGAGGG - Intronic
911120286 1:94289529-94289551 TTGAATAGGAATGGTAAGAGAGG + Intergenic
911129099 1:94370984-94371006 TTGAGTAAGATTGGTGAGGGTGG + Intergenic
911240227 1:95457238-95457260 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
911284252 1:95971000-95971022 TTGAATAAGAGTGGTAAGAGAGG + Intergenic
911464699 1:98236988-98237010 TTTAATAAGAGTGATGAGAGAGG - Intergenic
911638300 1:100260368-100260390 TTGAATAGGAGTGATGAGAGAGG + Intergenic
911929846 1:103888196-103888218 TTGAATAGGAGTGATGAGAGCGG - Intergenic
912036920 1:105328481-105328503 TTGAATAAGAGTAATAAGAGAGG - Intergenic
912081252 1:105939620-105939642 TTGAATAGGAGTGATAAGAGGGG + Intergenic
912361856 1:109101796-109101818 CTGAATTAGAATTATCAGGGAGG + Intergenic
912479334 1:109967856-109967878 TTGAAAAGGAATGGTTAGCGGGG - Intergenic
912562568 1:110561113-110561135 TTGAAAATGAATCATGAGGGTGG - Intergenic
913028152 1:114867795-114867817 TTGAAAAAGAATGGTGAGAGGGG + Intronic
913512889 1:119578293-119578315 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
913719580 1:121578364-121578386 TTGAATAGGAGTGATGAGAGAGG - Intergenic
914472258 1:147991486-147991508 TTGAATAAGAGTGGTGAGAGAGG + Intronic
914979674 1:152402238-152402260 TTGAATAGGAGTGATGAGAGAGG + Intergenic
915618883 1:157066393-157066415 TTGAATAGGAATGGTGAGAGAGG + Intergenic
915710043 1:157887522-157887544 TTGAATAAGAATGATTAGGGTGG - Intronic
915763916 1:158343700-158343722 TTGAATAAGAGTGGTGAGAGTGG + Intergenic
915816080 1:158966815-158966837 TTGAATAGGAATGGTGAGGGAGG - Intronic
915833743 1:159156279-159156301 TTGAATAGGAGTGATGAGAGAGG + Intergenic
915852984 1:159347859-159347881 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
915871711 1:159567377-159567399 TTAAATAGGAATGATGAGAGGGG - Intergenic
916078397 1:161216805-161216827 TTGAAAGAGAATGACTGGGGAGG + Intronic
916140941 1:161697257-161697279 TTGAATAGGAGTGATGAGAGAGG - Intergenic
916467726 1:165089051-165089073 TTGAATAGGAGTGATGAGAGAGG - Intergenic
916469097 1:165105256-165105278 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
916614481 1:166425494-166425516 TTGAATAGGAGTGATAAGAGAGG + Intergenic
916827748 1:168459065-168459087 TTGAATAGGAGTGGTTAGAGAGG + Intergenic
916848656 1:168680306-168680328 TTGAATAGGAGTGATTAGAGAGG + Intergenic
916926999 1:169532301-169532323 TTGAATAAGAGTGATGAGATTGG - Intronic
916985544 1:170187559-170187581 TTGAATAGGAATGGTGAGAGAGG + Intergenic
917092106 1:171363640-171363662 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
917192776 1:172435699-172435721 TTGAATAGGAGTGATGAGAGAGG - Intronic
917234877 1:172880651-172880673 TTGAATAAGAGTGGTGAGAGTGG + Intergenic
917381279 1:174411271-174411293 TTGAATAGGAGTGATGAGAGTGG + Intronic
917446726 1:175112029-175112051 TTGAATAAGAGTGGTAAGAGTGG + Intronic
917524727 1:175777877-175777899 TTGAATAGGAGTGGTTAGAGAGG - Intergenic
917832716 1:178910299-178910321 TTGAATAGGAGTGGTTAGAGTGG + Intronic
918021454 1:180696505-180696527 TTGAATAAGAATGGTGAAAGTGG + Intronic
918185507 1:182123376-182123398 TTGAATAGAAATGACTAGAGTGG - Intergenic
918930791 1:190854165-190854187 TTGAATAAGAGTGGTAAGAGTGG + Intergenic
918966345 1:191354410-191354432 TTGAATAGGAGTGATGAGAGTGG + Intergenic
918973035 1:191444812-191444834 TTGAATAGGAATGGTGAGAGAGG + Intergenic
919003461 1:191864808-191864830 TTGAATAACAATGGTGAAGGTGG - Intergenic
919088223 1:192946927-192946949 TTGAATAAGAATGTATAATGAGG - Intergenic
919295571 1:195695322-195695344 TTGAATAAGAGTGATGAGAGTGG + Intergenic
919578464 1:199340856-199340878 TTGAATAGGAGTGATGAGAGAGG - Intergenic
919603533 1:199651419-199651441 TTGAATAGGAGTGATGAGAGAGG - Intergenic
919622576 1:199879468-199879490 TGGAAAAAGGATGAATAGGGAGG + Intergenic
920064929 1:203262058-203262080 TTGAATAGGAGTGGTGAGGGAGG - Intronic
920085845 1:203416072-203416094 TTGAATAGGAATGGTGAGAGAGG - Intergenic
920778559 1:208965404-208965426 TTGAATAAGAGTGGTGAGAGTGG + Intergenic
921038316 1:211404330-211404352 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
921087278 1:211806895-211806917 TTAAATAAGAGTGATGAGAGTGG - Intronic
921242463 1:213199600-213199622 TTGAATAAGAGTGGCAAGGGAGG - Intronic
921401004 1:214723729-214723751 TTGAATAGGAGTGATGAGAGAGG + Intergenic
921440055 1:215175005-215175027 TTGAATAGGAGTGATGAGAGAGG + Intronic
921461868 1:215437241-215437263 TTGAATAAGAGTGATTAAAGTGG + Intergenic
921675457 1:217970579-217970601 TTGAATAGGAATGGTGAGAGTGG + Intergenic
921751537 1:218800138-218800160 TTGAATAGGAGTGGTGAGGGTGG + Intergenic
921881404 1:220258690-220258712 TTGAATAAGAGTGGTGAGAGAGG - Intronic
922383495 1:225057566-225057588 TTGAATAAGAGTGGTGAGAGAGG + Intronic
922401937 1:225268432-225268454 TTGAATAGGAGTGGTTAGAGAGG - Intronic
922971425 1:229744027-229744049 TTGAATAGGAATGGTGAGAGTGG + Intergenic
923345648 1:233049563-233049585 TTGAATAGGAGTGATAAGAGTGG - Intronic
923522818 1:234749269-234749291 TTGATTAAAAATGAGTAGAGAGG + Intergenic
923630344 1:235645499-235645521 TTGAATAAGAATGTTCAGGCTGG + Intronic
923947376 1:238903247-238903269 TTGAATATGAGTGATGAGAGAGG - Intergenic
924130013 1:240897319-240897341 TTGAATAGGAATGGTGAGAGAGG + Intronic
924492794 1:244555537-244555559 TTGAATACGAGTGGTGAGGGTGG - Intronic
924861595 1:247929227-247929249 CTGAATGAGAATGTTTAGGTCGG - Intergenic
924878589 1:248132764-248132786 TTGAATAGGAATGGTGAGAGAGG - Intergenic
924929765 1:248719685-248719707 TTGAATAAGAATGGTGAAAGTGG - Intronic
1063326366 10:5107470-5107492 CTGAATATGGATAATTAGGGTGG - Exonic
1064370116 10:14744385-14744407 TTGAATAGGAATGGTGAGAGAGG + Intronic
1064473974 10:15666556-15666578 TTGAATAGGAGTGATGAGAGAGG + Intronic
1064599488 10:16978796-16978818 TTGAATAGGAGTGGTTAGAGAGG - Intronic
1064671444 10:17718847-17718869 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1064702122 10:18032687-18032709 TTGAATAGGAGTGGTGAGGGAGG + Intronic
1064792445 10:18973346-18973368 TTGAATAGGAGTGATGAGAGTGG - Intergenic
1064880653 10:20049313-20049335 TTGAATAAGAATGACGACAGAGG - Intronic
1064958871 10:20941537-20941559 TTGAATAGGAGTGATGAGAGAGG - Intronic
1065080612 10:22125948-22125970 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1065247525 10:23773997-23774019 TTGAATAGGAGTGGTGAGGGAGG + Intronic
1065396936 10:25249349-25249371 TTGAATAGGAGTGGTGAGGGAGG + Intronic
1065502392 10:26395020-26395042 TTGCATATAAAAGATTAGGGTGG + Intergenic
1065635929 10:27734093-27734115 CAGAATAACAATGTTTAGGGGGG - Intronic
1065799243 10:29336011-29336033 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1066077449 10:31894201-31894223 TTGAATAGGAGTGATGAGAGAGG - Intronic
1066139017 10:32484534-32484556 TTGAATAGGAGTGGTGAGGGAGG + Intronic
1066172888 10:32870634-32870656 TTGAATAGGAGTGATGAGAGAGG + Intronic
1066522900 10:36242666-36242688 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1066751858 10:38665964-38665986 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1066785951 10:39004472-39004494 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1066819766 10:39470785-39470807 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1066965182 10:42257128-42257150 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1066983273 10:42439351-42439373 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1067240712 10:44490264-44490286 TTGAATAGGAATGGTTAGAGAGG - Intergenic
1068154198 10:53175248-53175270 TTGTAAAAGAGAGATTAGGGAGG + Intergenic
1068490709 10:57720169-57720191 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1068505612 10:57895921-57895943 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1068516644 10:58033382-58033404 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1068662961 10:59642435-59642457 TTGAATAAGAGTGGTGAGAGTGG + Intergenic
1068728457 10:60329237-60329259 TTGAATAAAAATGGTGAGAGAGG - Intronic
1068848912 10:61713548-61713570 TTGAATAGGAATGGTGAGAGAGG + Intronic
1069066428 10:63946679-63946701 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1069274953 10:66578354-66578376 TTGAATAGGAATGGTGAGTGTGG + Intronic
1069356606 10:67593796-67593818 TTGAATAGGAGTGATGAGGGTGG + Intronic
1070062105 10:72993982-72994004 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1070065040 10:73025566-73025588 TTGAATAGGAGTGGTGAGGGAGG - Intronic
1070226404 10:74511838-74511860 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1070454860 10:76602903-76602925 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1070584632 10:77754003-77754025 TTGAATAAGAGTGGTAAGAGTGG - Intergenic
1070990134 10:80724549-80724571 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1071035098 10:81235342-81235364 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1071101751 10:82046606-82046628 TTGAATAGGAGTGGTGAGGGAGG + Intronic
1071323898 10:84492505-84492527 TTGAATAAGAATTATGAGAATGG + Intronic
1071401410 10:85276441-85276463 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1071652382 10:87405230-87405252 TTGAATAAGAATGGTGAAAGTGG - Intergenic
1071748349 10:88447116-88447138 TTGAATAGGAATGGTGAGAGAGG - Intronic
1072364920 10:94699581-94699603 TTGAATAGGAGTGATGAGAGAGG - Intronic
1072373952 10:94794944-94794966 TTGAATAGGAGTGATGAGAGAGG + Intronic
1072380383 10:94862945-94862967 TTGAATAACAATGATGACAGTGG - Intergenic
1072384520 10:94910749-94910771 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1072387355 10:94944634-94944656 TTGAATAAGAGTGGTGAGAGAGG - Intronic
1072392669 10:95004053-95004075 TTGAATAACAATGATGACAGTGG - Intergenic
1072407139 10:95165918-95165940 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1072770471 10:98133620-98133642 GTGAATATTAATGAGTAGGGAGG + Intergenic
1072849630 10:98874648-98874670 TCGAATAGGAATGATGAGAGAGG + Intronic
1072876562 10:99179223-99179245 TTGAATAGCAATGGTTAGAGAGG - Intronic
1073587189 10:104722015-104722037 TTGAATAGGAGTGATGAGAGGGG + Intronic
1073647490 10:105320650-105320672 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1073661066 10:105476855-105476877 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1074623580 10:115152752-115152774 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1074645773 10:115450235-115450257 TTGAATAAGACTGGTGAGAGAGG - Intronic
1074648123 10:115487767-115487789 TTGAATAGGAGTGATGAGAGAGG + Intronic
1074682763 10:115925285-115925307 TTGCATAAGAATGGTGAGAGAGG + Intronic
1074933542 10:118154826-118154848 TTGAATAGGAATGATGAGAGTGG - Intergenic
1075860444 10:125671170-125671192 TTGAATAGGAATGGTGAGAGGGG + Intronic
1076227704 10:128793487-128793509 TTGAATAGTAAAGATTATGGGGG - Intergenic
1076234120 10:128850568-128850590 GTGAATAAAAATGACTGGGGTGG - Intergenic
1076390230 10:130094830-130094852 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1076660183 10:132050673-132050695 TTGTATGGGAATGATCAGGGTGG - Intergenic
1077166663 11:1144169-1144191 TTGAATAAGAGCGATGAGAGGGG - Intergenic
1077567561 11:3312277-3312299 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1077687162 11:4304771-4304793 TTCAATAAGAATGTATAGGTTGG + Intergenic
1077937816 11:6808321-6808343 TTGAATAAGAGTGGTGAGAGTGG + Intergenic
1078046906 11:7922297-7922319 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1078115675 11:8447740-8447762 TTGAATAGGAATGGTGAGAGAGG - Intronic
1078119667 11:8494051-8494073 TTGAATAGGAATGGTGAGAGAGG - Intronic
1078684296 11:13513585-13513607 TTGAATAGGAATGGTGAGAGTGG + Intergenic
1079518152 11:21292029-21292051 TTGAATAGGAATGTTGAGAGAGG - Intronic
1079581465 11:22069645-22069667 TTGAATAGGAGTGGTTAGAGAGG - Intergenic
1079675245 11:23218708-23218730 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1079681952 11:23308112-23308134 CTGAATAAGAATGAAAAGGTAGG - Intergenic
1079992674 11:27263020-27263042 TTTAATCAGAATGATTGAGGGGG - Intergenic
1080117860 11:28640661-28640683 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1080176655 11:29370833-29370855 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1080221328 11:29908688-29908710 TTGAATAGGAATGATAAGAGAGG - Intergenic
1080318288 11:30975324-30975346 TTGAATAAGAATGGTGAGAGTGG - Intronic
1080357300 11:31464895-31464917 TTGAATAAGAGTGGTGAAGGTGG - Intronic
1080449028 11:32363548-32363570 ATGAATAAGAAGGATTTGGGAGG + Intergenic
1080591519 11:33727626-33727648 TTGAATAGGAATGGTGAGAGAGG - Intronic
1080782692 11:35445378-35445400 TTGAATAGGAGTGATGAGAGAGG + Intronic
1080906230 11:36548228-36548250 TTGAATAGGAGTGGTGAGGGAGG - Intronic
1080982911 11:37429932-37429954 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1081241066 11:40707248-40707270 TTGAATAGGAGTGGTGAGGGAGG + Intronic
1081424981 11:42916329-42916351 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1081513008 11:43795356-43795378 TTGAATAAGAATTATAATGGAGG - Intronic
1081798208 11:45837123-45837145 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1081826062 11:46053057-46053079 TAGAATAATAATGCTTTGGGAGG - Intronic
1082200470 11:49360338-49360360 TTGAATAAGAGTGGTGAGAGTGG + Intergenic
1082279397 11:50255202-50255224 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1082316082 11:50724200-50724222 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1082317247 11:50745021-50745043 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1082674311 11:56077006-56077028 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1082703088 11:56457947-56457969 TTGAATAGGAGTGATGAGTGTGG - Intergenic
1082926786 11:58556646-58556668 ATGAATAAAAAAGATCAGGGTGG + Intronic
1082994300 11:59237673-59237695 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1083515861 11:63257843-63257865 TTGAATAGGAGTGATGAGAGAGG + Intronic
1083532729 11:63439264-63439286 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1084924417 11:72501169-72501191 TTGAATAGGACTGATGAGAGTGG + Intergenic
1085135297 11:74082024-74082046 TTGAATAGGAATGGTGAGAGAGG + Intronic
1085653262 11:78287946-78287968 TTGAATAAGAGTGATAACAGTGG - Intronic
1085748252 11:79133950-79133972 TTGAAGAAGAGTGATGAGAGTGG - Intronic
1085908414 11:80792366-80792388 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1085909257 11:80801905-80801927 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1086029936 11:82342431-82342453 TTGAATAGGAATGGTGAGAGTGG + Intergenic
1086082462 11:82919133-82919155 TTGAAGAAGAATGGTGAGAGTGG + Intronic
1086086858 11:82964329-82964351 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1086224359 11:84489780-84489802 TTGAATATGGATGATTAGGAAGG - Intronic
1086264621 11:84983026-84983048 TTGAATAAAAAGGATGAGGGTGG - Intronic
1086456506 11:86964118-86964140 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1086514221 11:87593095-87593117 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1086543163 11:87937008-87937030 TTGAATAAGAGTGGTTAGAATGG + Intergenic
1086567609 11:88244565-88244587 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1086574486 11:88323373-88323395 TTGAATAAGAATGGTGAGAGAGG - Intronic
1086655206 11:89345900-89345922 TTGAATAAGAGTGGTGAGAGTGG - Intronic
1087110470 11:94461574-94461596 TTGAATAGGAGTGATGAGAGAGG - Intronic
1087215774 11:95492062-95492084 TTGAATAAGAATGGTGAGAGTGG + Intergenic
1087363837 11:97194761-97194783 TTGAATAAGAGTGATGAGAGGGG + Intergenic
1087679807 11:101207513-101207535 TTGAATAACAGTGATGAGAGTGG + Intergenic
1087707854 11:101515134-101515156 TTGAATAATTATGATTAAGAAGG - Intronic
1087878560 11:103388541-103388563 TTGAATAGGAATGGTGAGAGAGG + Intronic
1087881640 11:103422790-103422812 TTGAATAGGAGTGGTGAGGGAGG - Intronic
1088052088 11:105529279-105529301 TTGATCAAGAATGATGAGAGAGG + Intergenic
1088343414 11:108795181-108795203 TTGACTCAGAATGATTTGGGAGG + Intronic
1088405261 11:109469098-109469120 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1088521189 11:110702489-110702511 TTGAATAGGAATGGTGAGAGAGG - Intronic
1088845299 11:113660697-113660719 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1089087341 11:115833172-115833194 TTGAATAAGAGTGATGAAAGTGG - Intergenic
1089658158 11:119967120-119967142 TGGAACAAGAATTATTAGGTTGG + Intergenic
1090091260 11:123700561-123700583 TTGAATAAGAGTGATGAGAGAGG + Intergenic
1090114476 11:123953744-123953766 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1090217206 11:124979805-124979827 TTGAATAGGAATGATGAGAGAGG + Intronic
1090412293 11:126517622-126517644 TAGAAGAAAACTGATTAGGGTGG - Intronic
1090642252 11:128739646-128739668 TTGAATTTGATTTATTAGGGGGG + Intronic
1090895699 11:130972789-130972811 TTGAATAAGAATGGTGAGAGAGG + Intergenic
1091297093 11:134481684-134481706 TTAAATAAGCATGATTTTGGAGG - Intergenic
1091365173 11:135013224-135013246 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1091809504 12:3384107-3384129 TTGAATAAGAGTGGTAAGAGAGG + Intronic
1092188768 12:6502058-6502080 TTGAGTAGGAATGATCAGAGAGG + Intronic
1092334071 12:7613020-7613042 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1092438044 12:8468891-8468913 TTGAATAAAAATGGTAAGAGTGG - Intronic
1092519329 12:9251309-9251331 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1092579629 12:9824568-9824590 TTGAATAGGAATGTTGAGAGTGG - Intergenic
1092596951 12:10017457-10017479 TTGATTAAGAGTGAGTAGAGAGG - Intronic
1092639541 12:10489136-10489158 TTGAATAGGAGTGATGAGAGTGG + Intergenic
1092679019 12:10956525-10956547 TTGAATAAGAGTGGTGAGAGAGG - Intronic
1093262433 12:16955483-16955505 GTGAATAAGACTGTCTAGGGAGG + Intergenic
1093319006 12:17689268-17689290 TAGAATAAGAAAGATTACTGGGG - Intergenic
1093319891 12:17701414-17701436 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1093361288 12:18232127-18232149 TTGAATAAGAGTGGTCAGAGTGG + Intronic
1093413274 12:18892260-18892282 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1093599697 12:21006785-21006807 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1093606739 12:21100128-21100150 TTGATTAAGAATGGTGAGAGTGG + Intronic
1093677011 12:21954322-21954344 TTGAATAGGAATAATGAGAGTGG + Intergenic
1093693486 12:22134089-22134111 TTGAATAGGAGTGATGAGGGAGG - Intronic
1093952507 12:25179896-25179918 TTGAATAGGAATGATGAGAGTGG - Intronic
1093974519 12:25406532-25406554 TTGAATAAGAGTGATAAGGTTGG - Intergenic
1094273528 12:28643603-28643625 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1094710802 12:32960272-32960294 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1094745121 12:33335817-33335839 TTGAATAGGAATGGTGAGAGGGG - Intergenic
1094788594 12:33881838-33881860 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1094862211 12:34480397-34480419 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1095060785 12:37685707-37685729 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1095074184 12:37896487-37896509 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1095090000 12:38095417-38095439 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1095217386 12:39565666-39565688 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1095306036 12:40640084-40640106 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1095608182 12:44095820-44095842 TTGAATAGGAGTGGTGAGGGAGG - Intronic
1095610700 12:44124440-44124462 TTGAATAGGAGTGATGAGAGAGG + Intronic
1095623915 12:44291533-44291555 TTAAATAGAAATGATGAGGGTGG + Intronic
1095647189 12:44561282-44561304 TTGAATAGGAATGGTGAGAGAGG - Intronic
1095653066 12:44636321-44636343 TTGAATAGGAGTGATGAGAGAGG + Intronic
1095674649 12:44902005-44902027 TTGAATAGGAGTGATGAGAGAGG - Intronic
1095697878 12:45161161-45161183 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1095788716 12:46140500-46140522 TTGAATAACAATGGTGAGAGTGG + Intergenic
1095866277 12:46975837-46975859 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1096010155 12:48206516-48206538 TTGAATAAGAGTGATGAGAGGGG - Intergenic
1096028845 12:48393368-48393390 TTTAATAGGAATGGTGAGGGAGG + Intergenic
1096034321 12:48451445-48451467 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1096087197 12:48873682-48873704 TGGACTAAGAATGAGGAGGGAGG + Intergenic
1096563804 12:52458642-52458664 TTGAATAGGAGTGATAAGAGAGG + Intergenic
1096894657 12:54808982-54809004 TTGAACAAGAGTGATGAGAGAGG + Intergenic
1097499124 12:60379664-60379686 TTAAATAAGAGTGATCAGAGAGG - Intergenic
1097898463 12:64850310-64850332 TTGAATAGGAGTGATGAGAGAGG + Intronic
1097924614 12:65113431-65113453 TAGAATCAGAATAAATAGGGAGG + Intronic
1097948431 12:65399639-65399661 TTGAATAGGAATGGTGAGAGAGG + Intronic
1098098558 12:66987627-66987649 TTGGAAAAGATTGATTGGGGTGG - Intergenic
1098145514 12:67493764-67493786 TTGAACAGGAATGATGAGAGAGG - Intergenic
1098238447 12:68441777-68441799 TTGAATAAGAGTGGTAAGAGTGG - Intergenic
1098282634 12:68877075-68877097 TTGAAGAAGAAGGATTAGCTAGG - Intronic
1098354186 12:69595021-69595043 TTGAAAATGAATGAATAGGTTGG + Intronic
1098371487 12:69765177-69765199 TTGAATAGGAATGGTGAGAGTGG + Intronic
1098652999 12:72997662-72997684 TTGAATAAGACTGGTGAGAGAGG + Intergenic
1098678945 12:73325715-73325737 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1098764635 12:74470387-74470409 TTGAATAAGAGTGATAAGAGAGG - Intergenic
1099031202 12:77527851-77527873 TTGAATAGGAGTGGTGAGGGGGG - Intergenic
1099239769 12:80125075-80125097 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1099253001 12:80281232-80281254 TTGAATGAGAGTGATGAGAGTGG + Intronic
1099253354 12:80285909-80285931 TTGAATAAGAGTGGTAAGAGGGG + Intronic
1099313609 12:81058376-81058398 TTGAATAGGAATGGTGAGAGAGG + Intronic
1099388576 12:82049938-82049960 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1099435584 12:82641201-82641223 TTGAATAAAAATGATGAAAGTGG - Intergenic
1099572727 12:84345323-84345345 TTGAATCAGAGTGATGAGAGTGG + Intergenic
1099695999 12:86020229-86020251 TTGAATAGGAGTGTTGAGGGAGG + Intronic
1099736753 12:86577343-86577365 TTGAATAACAGTGGTTAGAGTGG + Intronic
1100174865 12:92017977-92017999 TTGAATAGGAATGGTGAGAGTGG + Intronic
1100328125 12:93560309-93560331 TTGAATAGGAATGGTAAGAGAGG - Intergenic
1100547371 12:95615893-95615915 CTGAATCAGAATTTTTAGGGTGG + Intergenic
1100648939 12:96563382-96563404 TTGAATAAGAATGCTAATGTAGG - Intronic
1100968828 12:100044702-100044724 TTGAATAGGAATGATGAGAGAGG - Intronic
1101295139 12:103414921-103414943 TTGAATAAGAGTGGTGAGAGGGG + Intronic
1101790468 12:107922031-107922053 TTGAATAGGAGTGGTAAGGGAGG - Intergenic
1102278797 12:111601940-111601962 TTGAATAAGAAGGCCTAGGCTGG + Intergenic
1103022334 12:117544868-117544890 TTGAATAAGAATGGTGAGAGTGG + Intronic
1103071551 12:117948076-117948098 TTGAAAAAGAATAATAAAGGTGG + Intronic
1104194193 12:126515790-126515812 TTCAGTAAGAATGAATAGTGAGG - Intergenic
1104794080 12:131504726-131504748 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1105201733 13:18186279-18186301 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1106094616 13:26632209-26632231 TTGAATAAGCATGGTGAGAGAGG + Intronic
1106215600 13:27695725-27695747 TTGAATAGGATTGATGAGAGTGG + Intergenic
1106366588 13:29087139-29087161 TTGAATAGGAATGGTGAGAGTGG + Intronic
1106374628 13:29173619-29173641 TTCAGGATGAATGATTAGGGTGG + Intronic
1106648228 13:31660336-31660358 TTGAATAAGATTGGTGAGAGTGG + Intergenic
1106791465 13:33159069-33159091 TTGTATAAAAATGGTTAGAGTGG - Intronic
1106791570 13:33160960-33160982 TTGAATATGAATGTTTAGAGTGG + Intronic
1106887532 13:34205726-34205748 TTGAAAAGAAATGATTTGGGGGG + Intergenic
1107587010 13:41861409-41861431 TTGAATAGGAATGGTGAGAGTGG - Intronic
1107763910 13:43712950-43712972 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1108139506 13:47404805-47404827 ATGAATAAGTATGATTAGATTGG - Intergenic
1108145022 13:47467635-47467657 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1108168397 13:47716244-47716266 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1108425614 13:50296352-50296374 TTGAATAGGAATGGTGAGAGAGG + Intronic
1108815287 13:54283364-54283386 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1108822143 13:54365527-54365549 TTGAATAAGAATGATTATATAGG - Intergenic
1108976856 13:56455456-56455478 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1109037232 13:57280593-57280615 TTGAATAAAAGTGATGAGAGTGG - Intergenic
1109101086 13:58184178-58184200 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1109162585 13:58993714-58993736 TTTCATAAGAATTATTATGGGGG - Intergenic
1109186310 13:59272952-59272974 TTGAATAAGAGTGGTGAGAGTGG + Intergenic
1109366884 13:61367391-61367413 TTGAATAAGAATGGTGAGAGAGG - Intergenic
1109386773 13:61639798-61639820 TTAAATAAGAATGGTAAGGCAGG + Intergenic
1109479521 13:62930596-62930618 TTGAATAGGAGTGGTTAGAGTGG - Intergenic
1109533491 13:63684824-63684846 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1109540975 13:63778465-63778487 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1109635171 13:65105946-65105968 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1109774783 13:67026517-67026539 TTGAATAGGAGTGGTGAGGGAGG - Intronic
1109816102 13:67586995-67587017 TTGAATAAGAGTGATGAAAGTGG + Intergenic
1109877314 13:68422511-68422533 TTGAATAGGAGTGATCAGAGTGG + Intergenic
1109941293 13:69369431-69369453 TTGAATAGGAGTGGTGAGGGTGG - Intergenic
1110077786 13:71270970-71270992 TTGAATAATAATGATAATAGTGG + Intergenic
1110086458 13:71386600-71386622 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1110301166 13:73928925-73928947 TTCAATAAGAATGTCTATGGGGG - Intronic
1110349769 13:74493721-74493743 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1110488784 13:76078241-76078263 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1110510693 13:76346688-76346710 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1110559031 13:76890077-76890099 TTGGATAAGAAGGATTACTGTGG - Intergenic
1110606582 13:77439860-77439882 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1110737090 13:78949857-78949879 TTGAATAGGAGTGGTTAGAGAGG + Intergenic
1110788812 13:79564612-79564634 TTGAATAGGAGTGATAAGAGAGG - Intergenic
1110899993 13:80810222-80810244 TTGAATAGGAATGGTAAGAGAGG + Intergenic
1110907821 13:80915335-80915357 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1110961255 13:81629126-81629148 TTGAATAGGAGTGGTTAGAGAGG + Intergenic
1111088069 13:83402358-83402380 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1111393661 13:87633940-87633962 TTGAATAGGAGTGATGAGAGTGG - Intergenic
1111415227 13:87932145-87932167 TTGAATAAGATTTTTTTGGGGGG + Intergenic
1111428529 13:88122091-88122113 TTGAATAGGAGTGATGAGAGTGG + Intergenic
1111786558 13:92794487-92794509 TTGAATAGGAATGGTGAGAGAGG - Intronic
1111808748 13:93070923-93070945 CTGAATAGGAATGATGAGAGAGG + Intergenic
1111817830 13:93176343-93176365 TTGAATAGGAATGGTGAGAGTGG - Intergenic
1111908038 13:94278473-94278495 TTGAATATGAGTGATGAGAGAGG + Intronic
1112019812 13:95361917-95361939 CTGCATAAAAAAGATTAGGGTGG + Intergenic
1112130725 13:96520884-96520906 TTGAATAGGAGTGATGAGAGAGG + Intronic
1112134410 13:96560477-96560499 TTGAATAGGAATGGTGAGAGTGG - Intronic
1112166227 13:96922819-96922841 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1112473285 13:99708795-99708817 TTTAAGAAGAGTGATTAGGCTGG + Intronic
1112592852 13:100779894-100779916 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1112645298 13:101324813-101324835 TTGAATAGGAGTGGTGAGGGAGG + Intronic
1112860659 13:103826301-103826323 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1113169869 13:107488727-107488749 TTGAATAAGAGTGTTGAGAGAGG - Intronic
1113257555 13:108523550-108523572 TTGAATAAGATTGAATAAGATGG - Intergenic
1113342823 13:109443524-109443546 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1114150990 14:20039183-20039205 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1114386246 14:22258397-22258419 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1114432533 14:22674084-22674106 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1114586785 14:23822444-23822466 TTGAATACGAATGATGAGACAGG + Intergenic
1114684916 14:24519527-24519549 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1114708808 14:24755844-24755866 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1114749525 14:25187506-25187528 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1114800781 14:25773355-25773377 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1114907307 14:27146326-27146348 TTGAATAAGGGTGGTTATGGTGG + Intergenic
1114932770 14:27494390-27494412 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1114971454 14:28034817-28034839 TTGAATAAGAATGGTGAAAGAGG - Intergenic
1114981632 14:28172092-28172114 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1115005244 14:28474791-28474813 TTGAATAAGAGTGGTGAGAGCGG + Intergenic
1115056509 14:29134510-29134532 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1115184305 14:30667509-30667531 TTGAATAAGAGTGGTGAGAGAGG - Intronic
1115359617 14:32486854-32486876 TTGAATAGGAGTGATGAGAGAGG + Intronic
1115869373 14:37782665-37782687 TTGAATAGGAGTGATGAGAGAGG + Intronic
1115932937 14:38518174-38518196 TTGAATAGGACTGATGAGAGAGG - Intergenic
1115950370 14:38714407-38714429 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1116035673 14:39624508-39624530 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1116060971 14:39923548-39923570 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1116583862 14:46677451-46677473 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1116601935 14:46936897-46936919 TTGAATAAGAGTGGTAAGAGTGG - Intronic
1116670915 14:47842240-47842262 TTGAATATGAGTGATGAGAGGGG + Intergenic
1116675872 14:47905143-47905165 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1116776027 14:49181788-49181810 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1117082021 14:52161793-52161815 TTGAATAGGAATGGTGAGAGTGG - Intergenic
1117115531 14:52507017-52507039 TTGAATAAGAGTGGTGAGAGAGG - Intronic
1117607738 14:57448063-57448085 TTGAAAAGGAATGATAAGAGAGG + Intergenic
1117917726 14:60695606-60695628 TTGAATAAGAGTGGTGAGAGTGG + Intergenic
1117952233 14:61094301-61094323 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1118545086 14:66877340-66877362 TTGAATAGGAATGGTGAGAGAGG - Intronic
1118569241 14:67176114-67176136 TTGAATAGGAATGGTGAGAGAGG + Intronic
1118658070 14:67975422-67975444 TTGAATAAATATGATAAGGCTGG - Intronic
1118957940 14:70500136-70500158 TTGAATAAGAGTGGTTAGAGAGG - Intergenic
1119079434 14:71678178-71678200 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1119100436 14:71874680-71874702 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1119152821 14:72379286-72379308 TTGAATAAGAATGGTAAGAGTGG - Intronic
1120058831 14:79957654-79957676 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1120158830 14:81123682-81123704 TTGAAAAACAATGATTAAGTGGG - Intronic
1120371664 14:83643274-83643296 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1120564975 14:86044370-86044392 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1120577368 14:86199679-86199701 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1120599459 14:86483540-86483562 TTGAATAAGAATGTTGATAGAGG - Intergenic
1120773565 14:88408645-88408667 TTGAATAGGAGTGATGAGAGAGG + Intronic
1121160996 14:91740229-91740251 TTGAATAAAACTGATGAGAGTGG - Intronic
1121759411 14:96432146-96432168 TTGAATAGGAGTGATGAGAGAGG + Intronic
1122148835 14:99712240-99712262 TTGAATAAGAGTGATGAAAGTGG - Intronic
1123397552 15:19952304-19952326 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1123424871 15:20162839-20162861 TTGAATAAAAGTGATGAGGCTGG + Intergenic
1123534095 15:21169370-21169392 TTGAATAAAAGTGATGAGGCTGG + Intergenic
1123786440 15:23679369-23679391 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1124064675 15:26330682-26330704 TTCAATAGGAATGGTGAGGGAGG - Intergenic
1124450237 15:29781924-29781946 TTGAATAGGAGTGATGAGAGAGG - Intronic
1124453295 15:29818393-29818415 TTGAAAAACAAGAATTAGGGTGG - Intronic
1124668910 15:31619805-31619827 TTGAATAGGAATGGTGAGAGAGG + Intronic
1125354167 15:38799508-38799530 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1125408493 15:39380064-39380086 TTGAATAAGAGTGGTGAGAGTGG - Intergenic
1125985116 15:44042881-44042903 TTGAATAGGAATGGTGAGAGAGG - Intronic
1126086680 15:45017048-45017070 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1126233821 15:46358447-46358469 TTGAATAATAATGGTGAGAGAGG - Intergenic
1126234228 15:46363765-46363787 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1126276481 15:46888971-46888993 TTGAATAAAAGTGATTTGAGTGG - Intergenic
1126365841 15:47893557-47893579 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1126879586 15:53080162-53080184 TTGTTTAGGAATGATTAGGAAGG - Intergenic
1127146171 15:56026356-56026378 TTGAATAAGAATAGTGATGGTGG + Intergenic
1127876452 15:63115687-63115709 TTGAATAAGAAAGATTAGAGTGG + Intergenic
1128586416 15:68854744-68854766 TTGAATAACAGTGATGAGAGGGG + Intronic
1128679781 15:69640816-69640838 TTGAATAAGAGTGGTGAGGATGG + Intergenic
1128860101 15:71062736-71062758 TTGAATAAGAGTGGTAAGAGTGG + Intergenic
1129489678 15:75911801-75911823 TTGAATAGGAATGGTGAGAGAGG + Intronic
1129498764 15:76015379-76015401 TTGAATAGGAATGGTGAGAGAGG + Intronic
1129583309 15:76835647-76835669 TTGAATAGGAATGGTGAGGTGGG - Intronic
1130731824 15:86501878-86501900 TTGAAAAAGAATGAATCTGGAGG - Intronic
1130777758 15:87003015-87003037 TTGAATAGGAGTGATAAGAGAGG + Intronic
1130855701 15:87837720-87837742 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1130856233 15:87841987-87842009 TAGAATAAGATTGATCAAGGTGG + Intergenic
1131314839 15:91326205-91326227 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1131415493 15:92252643-92252665 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1131597896 15:93817269-93817291 TTGAGTAAGAGTGATGAGAGTGG - Intergenic
1131930605 15:97436796-97436818 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1131933864 15:97479369-97479391 TTGAATAAGAATGGTGAGAATGG + Intergenic
1132045166 15:98557592-98557614 CTGCAGAAGAATGATTAGGGTGG + Intergenic
1132144395 15:99419425-99419447 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1132254349 15:100362419-100362441 TTCAATAGGAATGATGAGAGAGG - Intergenic
1133086630 16:3369136-3369158 TTGAATTAGAAGGCTTAAGGTGG + Intronic
1134355803 16:13481009-13481031 TTAAATGAGTAAGATTAGGGTGG - Intergenic
1134786468 16:16948692-16948714 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1135833658 16:25802527-25802549 TTGAAAAAGAATGACAAGGAAGG - Intronic
1135834210 16:25809130-25809152 TTGAATAAGAGTGGTGAGAGTGG + Intronic
1136129954 16:28213391-28213413 TTGAATAGGAATGATGAGAAAGG + Intergenic
1136524420 16:30819646-30819668 TTGAATAAGAATAATAAGAATGG + Intergenic
1136727393 16:32371419-32371441 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1136730864 16:32411134-32411156 TTGAATAAGAGTGGTGAGGGAGG + Intergenic
1138145691 16:54609004-54609026 TTGAATAGGAATAGTTAGAGTGG - Intergenic
1138755020 16:59473750-59473772 TTGAATAAGAATGGTGAGAGTGG - Intergenic
1138890339 16:61135553-61135575 TTGCATAAGAATGATTGTAGTGG + Intergenic
1140036506 16:71375556-71375578 ATAAATAAGAATGATGATGGTGG + Intronic
1140618168 16:76692948-76692970 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1141119742 16:81343721-81343743 TTGAATAGGAATGGTGAGAGAGG - Intronic
1202995533 16_KI270728v1_random:106135-106157 TTGAATAAGAGTGGTGAGGGAGG - Intergenic
1202999040 16_KI270728v1_random:146331-146353 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1203022220 16_KI270728v1_random:418477-418499 TTGAATAAGAGTGGTGAGGGAGG - Intergenic
1203130638 16_KI270728v1_random:1682739-1682761 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1143243875 17:5467222-5467244 TTGAAAAAGATTAATTAGGCAGG - Intronic
1143258010 17:5577216-5577238 TTGAATAGGAGTGATGAGAGAGG - Intronic
1143264200 17:5623551-5623573 TTTGAAAAGATTGATTAGGGAGG + Intergenic
1143815642 17:9511691-9511713 TTGAGTAAGAGTGATGAGAGTGG - Intronic
1144432303 17:15204953-15204975 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1145359038 17:22196593-22196615 TTGAATAGGAGTGGTTAGAGTGG + Intergenic
1146040143 17:29445066-29445088 TTGATTAGGAGTGATTAGAGTGG + Intronic
1146580578 17:34034465-34034487 TTGAATAGGAATGGTGAGAGAGG - Intronic
1146718532 17:35106512-35106534 TTGGATAAGAGGGAGTAGGGGGG + Intronic
1147328225 17:39680420-39680442 TTGAATAGGAAGTATTAAGGAGG + Intronic
1148980508 17:51570327-51570349 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1149061160 17:52423741-52423763 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1149194740 17:54105972-54105994 TTGAATAAGAGTGGTGAGAGTGG - Intergenic
1149235872 17:54590076-54590098 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1149246834 17:54719024-54719046 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1149255773 17:54824768-54824790 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1149520106 17:57312331-57312353 TTGAAAAAGAAAAATTAGGAAGG - Intronic
1150538795 17:66075669-66075691 TTGAATGGGAATCATTATGGTGG + Intronic
1150826905 17:68484577-68484599 TTAAATAAGAGTGATGAGAGTGG + Intergenic
1151998188 17:77625402-77625424 TTGAATAAGAGTGGTGAGGGTGG + Intergenic
1203168020 17_GL000205v2_random:116530-116552 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1153077746 18:1184701-1184723 TTTAACAACTATGATTAGGGTGG - Intergenic
1153090703 18:1339303-1339325 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1153124734 18:1777286-1777308 GTGAATAAGAAAGAGTGGGGAGG + Intergenic
1153320377 18:3767875-3767897 TTGAATAAGCATGATAAGAGTGG - Intronic
1153349686 18:4065282-4065304 TTGAATAGGAGTGATGAGAGAGG - Intronic
1153606742 18:6841276-6841298 AAGAATAAGAAGGAATAGGGAGG - Intronic
1153857749 18:9167755-9167777 TTGAATAGGAGTGGTGAGGGAGG + Intronic
1153924915 18:9827263-9827285 ATGAATCAGAAGGATGAGGGAGG + Intronic
1154184351 18:12169171-12169193 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1154186195 18:12185729-12185751 TTGAATAAGAGTGGTAAGAGAGG - Intergenic
1155089943 18:22497871-22497893 TTGAATAAGAGTGATGAGAGTGG - Intergenic
1155115509 18:22762498-22762520 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1155581337 18:27310962-27310984 TTGAATAAGAGTGGTGAGTGTGG + Intergenic
1155773861 18:29734390-29734412 TTGAATAAGAGGGATGAGAGAGG + Intergenic
1155815091 18:30297419-30297441 TTGAATACGAATGGTGAGAGAGG + Intergenic
1156005303 18:32433388-32433410 TTGAATAAGAGTGGTAAGAGTGG - Intronic
1156084954 18:33386820-33386842 TTGAATAAGAGTGGTGAGTGAGG - Intronic
1156551072 18:38017541-38017563 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1156983755 18:43324619-43324641 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1157031217 18:43910663-43910685 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1157055651 18:44225568-44225590 TTGAATAAGAATGGTGAGAGAGG + Intergenic
1157059154 18:44266967-44266989 TTGAATAGGAATGATAAAAGTGG - Intergenic
1157350237 18:46877605-46877627 TTGAATATGAATAATTAGGTAGG - Intronic
1157396970 18:47350265-47350287 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1157694732 18:49712518-49712540 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1158168653 18:54571547-54571569 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1158173989 18:54633363-54633385 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1158398652 18:57100476-57100498 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1158413375 18:57227960-57227982 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1158647515 18:59260730-59260752 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1158724672 18:59959577-59959599 TTGAAGAAGAGTGATTTGGGAGG + Intergenic
1158771510 18:60522861-60522883 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1159146079 18:64455974-64455996 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1159333818 18:67037113-67037135 TTGAAGAAGAATAAGTTGGGAGG - Intergenic
1159632640 18:70766787-70766809 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1159761694 18:72434753-72434775 TGGAATAAGAATGACTGGAGGGG + Intergenic
1160131495 18:76229404-76229426 TTTAAGGAGAATGATCAGGGTGG - Intergenic
1160274437 18:77418017-77418039 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1160629525 18:80236455-80236477 TTGAATAGGAGTGGTGAGGGAGG - Intronic
1163936506 19:20449582-20449604 TTAAATCAAAATCATTAGGGAGG - Intergenic
1163995653 19:21044121-21044143 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1164065791 19:21715454-21715476 TTTAGTAAGACTGATTAGAGTGG - Intergenic
1164116723 19:22228458-22228480 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1164166071 19:22676322-22676344 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1164471539 19:28540012-28540034 TTGAATAAGAATAATGAGAGTGG - Intergenic
1164543114 19:29136681-29136703 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1164791272 19:30984836-30984858 TTGAATAGTAATGATAAGAGTGG + Intergenic
1165011404 19:32850135-32850157 TTGAATAGGAATGGTGAGAGAGG - Intronic
1165606108 19:37106069-37106091 TTGAATAGGAGTGATGAGAGAGG + Intronic
1165677652 19:37741779-37741801 TTGAATAAGAGTGGTGAGAGAGG - Intronic
1165910880 19:39226291-39226313 TTGAATAAGAATGGTGATAGAGG - Intergenic
1166159553 19:40941573-40941595 GTGAAGAACAAAGATTAGGGAGG + Intergenic
1166285009 19:41820226-41820248 TTGAATAAGGATGATGAGAGTGG + Intergenic
1166426126 19:42679815-42679837 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1166577831 19:43860413-43860435 TTGAATAAGAGTGCTGAGAGTGG - Intergenic
1167710491 19:51107628-51107650 TTGTATAAGACTGATTGGAGTGG + Intronic
1167763856 19:51466851-51466873 TTGAATAAGAGTGGTGAGAGTGG - Intergenic
1168392140 19:56018278-56018300 TTAAAGAACAATCATTAGGGTGG - Intronic
1168440311 19:56360027-56360049 TTGAATAAGAGTGGTGAGAGAGG - Intronic
1168505504 19:56930642-56930664 TTGACCATGAATGTTTAGGGTGG + Intergenic
1202653718 1_KI270707v1_random:29783-29805 TTGAATAGGAGTGATGAGAGAGG - Intergenic
925672104 2:6321757-6321779 TTGAATAGGAATGATGAGAGTGG - Intergenic
925750484 2:7085987-7086009 TTGAATAGGAATGGTGAGAGTGG + Intergenic
926454232 2:13044411-13044433 TTGAATAGGAATGGTGAGAGAGG - Intergenic
926557525 2:14376868-14376890 TTGAATAGGAGTGGTTAGAGTGG - Intergenic
926863480 2:17334077-17334099 TTGAAGCAGAATGGTTAGCGTGG + Intergenic
926935139 2:18079707-18079729 TTGAATAGGAGTGATGAGAGAGG - Intronic
927129390 2:20045302-20045324 TTTAAAAAGAATGATTAAGCTGG + Intronic
927614807 2:24582060-24582082 TTGAATAAGAGTGATGAAAGTGG - Intronic
928576597 2:32661805-32661827 TTGAATAGGAATGGTGAGGGAGG + Intronic
928608833 2:32971329-32971351 TTGAATAGGAGTGATGAGAGTGG + Intronic
928616612 2:33046151-33046173 TTGAATAGGAGTGATGAGAGAGG + Intronic
928631650 2:33199578-33199600 TTGAATAGGAATGGTGAGAGAGG - Intronic
928795728 2:35016533-35016555 TTGAATAGGAGTGGTTAGCGAGG - Intergenic
928802244 2:35108888-35108910 TTGAATAGGAGTGGTTAGCGAGG + Intergenic
928837474 2:35565101-35565123 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
929255750 2:39809731-39809753 TTGATTAGGAATGATGAGAGAGG + Intergenic
929276043 2:40025922-40025944 TTGAATAGGAATGGTGAGAGAGG - Intergenic
929331919 2:40692500-40692522 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
929379214 2:41330246-41330268 TTGCATTAGAATAATTTGGGTGG + Intergenic
929382688 2:41370979-41371001 TTGAATAGGAGTGATGAGAGAGG - Intergenic
929582415 2:43090466-43090488 TTGAATAAGAGTGTTTATAGTGG - Intergenic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
930289616 2:49477529-49477551 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
930529908 2:52576048-52576070 TTGAATAAGAGTGAAGAGAGTGG + Intergenic
930677174 2:54215285-54215307 TTGAATAGGAATGGTGAGAGAGG + Intronic
930861616 2:56080053-56080075 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
930935849 2:56950517-56950539 TTGAATAGGAATGATGACAGAGG + Intergenic
930948046 2:57100008-57100030 TTGAATAACAGTGGTGAGGGTGG + Intergenic
930951748 2:57150985-57151007 TTGAATAAGAGTGTTAAGAGAGG - Intergenic
930961961 2:57272888-57272910 TTGAATAGGAATGGTGAGAGAGG + Intergenic
931028503 2:58142669-58142691 TTCAATAAGAATGCTTATTGAGG + Intronic
931037823 2:58263037-58263059 TTGAATAGGAATGGTGAGAGAGG - Intergenic
931534065 2:63252386-63252408 TTGAACAGGAATGATGAGTGTGG - Intronic
931646674 2:64428707-64428729 TTGAATAAGAATATTGAGTGTGG + Intergenic
931907224 2:66855294-66855316 TTGAATAGGAATGGTGAGAGAGG + Intergenic
932045773 2:68348083-68348105 TTGAATAGGAATGGTGAGAGAGG - Intergenic
932542175 2:72666481-72666503 TTGAATAGGAATGGTGAGAGTGG - Intronic
932717626 2:74113399-74113421 TTGAATAAGAGTAATGAGAGTGG - Intergenic
932941635 2:76173569-76173591 TTGAATAGGAATGGTGAGAGAGG + Intergenic
933376209 2:81482406-81482428 TTGAATAAGAGTGGTGAGAGTGG + Intergenic
933410449 2:81918662-81918684 TTGAATAGGAGTGATGAGAGAGG + Intergenic
933550294 2:83768146-83768168 TTGAATAAGAGTGATGAGAGAGG - Intergenic
933602119 2:84343738-84343760 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
934012803 2:87842163-87842185 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
934015389 2:87875241-87875263 TTGAATAAGAATGGTAAGAGAGG + Intergenic
934314855 2:91908122-91908144 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
934316455 2:91925143-91925165 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
934458347 2:94194014-94194036 TTGAATAAAAGTGATGAGGCTGG - Intergenic
935000088 2:99005245-99005267 TTGAATAAGAGTGGTGAGAGAGG - Intronic
935075671 2:99741172-99741194 TTGAATAGGAGTGATGAGAGAGG - Intronic
935470436 2:103453199-103453221 TTTAATAAGAATTATTATGCAGG + Intergenic
935852477 2:107237515-107237537 TTGAATAGGAATGGTGAGAGAGG - Intergenic
936773906 2:115949183-115949205 TTGAATAAGAGTGATGAGAGAGG + Intergenic
936784370 2:116075756-116075778 TTGAATAAGAGTGGTAAGAGAGG + Intergenic
936884081 2:117288217-117288239 TTGAATAAAAATGATGAAAGTGG - Intergenic
937109948 2:119357686-119357708 TTGAATAAGAATGGTGAGAATGG - Intronic
937173891 2:119906769-119906791 TTGAATAAGAGTGGTCAGCGTGG - Intronic
937448561 2:121980003-121980025 TTGAATAAGAGTGAAGAGAGTGG + Intergenic
937633256 2:124127013-124127035 TTGAATAAGAGTGGTGAGAGAGG - Intronic
937665547 2:124483118-124483140 TTGAAGAAGAATGGTTAGTTTGG - Intronic
937719810 2:125080854-125080876 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
938123442 2:128651481-128651503 TTGAATAACAGTGATGAGAGTGG + Intergenic
938865548 2:135416061-135416083 TTGAATAGGAGTGATGAGCGAGG - Intronic
938871579 2:135482654-135482676 TTGAATAGGAATGGTGAGAGAGG + Intronic
939157309 2:138540780-138540802 TTGAATAGGAGTGGTGAGGGAGG + Intronic
939398718 2:141664311-141664333 TTGAATAAGAGTGGTCAGAGAGG - Intronic
939782073 2:146461341-146461363 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
939947548 2:148427948-148427970 TTGAATAGGAATGGTGAGAGAGG - Intronic
940393048 2:153154768-153154790 TTGAATAGGAATGGTGAGAGAGG + Intergenic
940437935 2:153676980-153677002 TTGAATAAGACTGATGAGAGTGG - Intergenic
940761945 2:157748435-157748457 GTGTTTAAGAATGATTGGGGAGG + Intronic
940986051 2:160053378-160053400 CTGAATAAGAATGATAGGGATGG - Intronic
941117130 2:161484996-161485018 TTGAATAAGAGTGGTAAGCGTGG - Intronic
941146218 2:161849438-161849460 TTGAATAAGAATGGTGAGAGTGG + Intronic
941205761 2:162570999-162571021 TTGAATAGGAGTGATGAGAGAGG - Intronic
941335484 2:164239270-164239292 TTTAAAAAGGATGATCAGGGAGG + Intergenic
941361787 2:164560574-164560596 ATTAATAAGAAGGATTGGGGGGG + Intronic
941681917 2:168409070-168409092 TTGAATAGGAGTGATGAGAGAGG + Intergenic
941725376 2:168854458-168854480 TTGAATAAAAAAGAATAGGATGG - Intronic
941776911 2:169403238-169403260 TTGAATAGGAATGGTGAGAGAGG - Intergenic
941882032 2:170490576-170490598 TTGAATAGGAGTGATGAGAGTGG + Intronic
941981030 2:171457017-171457039 TTGAATAGGAATGGTGAGAGTGG + Intronic
942601844 2:177648607-177648629 TTGAAAAAGAATAATAAGGAAGG + Intronic
942710212 2:178826007-178826029 TTGAATAAGAGTGGTAAGAGAGG + Intronic
942817849 2:180073612-180073634 TTGAATAGGAGTGATGAGAGTGG - Intergenic
942819603 2:180096640-180096662 TTGAATAGGAATGCTAAGAGCGG - Intergenic
943210744 2:184962649-184962671 TTGGATAAGAGTGTTAAGGGGGG + Intergenic
943227333 2:185194571-185194593 TTGAATAGGAGTGATGAGAGAGG - Intergenic
943234072 2:185295036-185295058 TTGAATAGGAATGGTGAGAGAGG - Intergenic
943374615 2:187060508-187060530 GTGAATAAGAATGTTTATTGAGG + Intergenic
943438895 2:187901718-187901740 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
943490759 2:188553218-188553240 TTGAATAGGAGTGATGAAGGTGG + Intronic
943598727 2:189888972-189888994 TTGAATAAGAGTGGTGAGAGAGG + Intronic
943814815 2:192239023-192239045 TTGAATAGGAGTGATGAGAGAGG + Intergenic
943898970 2:193407535-193407557 TTGAATAGGAATGATGAGAGAGG - Intergenic
943999114 2:194809981-194810003 TTGAATAGGAATGGTGAGAGAGG - Intergenic
944163299 2:196689783-196689805 TTGAATAGGAATGGTGAGAGAGG + Intronic
944301855 2:198132590-198132612 CTGGATAGGAAGGATTAGGGAGG + Intronic
944364093 2:198896031-198896053 TTGAATAGGAGTGATGAGAGAGG - Intergenic
944610111 2:201394712-201394734 ATGAATAAGAATTATTAAAGGGG - Intronic
944621634 2:201522113-201522135 TTGAATAAAAGTGGTTAGAGTGG - Intronic
944845284 2:203661989-203662011 TTAAATAACAATATTTAGGGAGG - Intergenic
945140491 2:206681411-206681433 TTGAATAGGAGTGATAAGAGAGG + Intronic
945346845 2:208728442-208728464 TTGAATAGGAATGGTGAGAGTGG + Intronic
945359159 2:208875725-208875747 TTGAATAAGACTGGTGAGGGTGG + Intergenic
945481195 2:210347609-210347631 TTGAATAGGAGTGATGAGAGAGG + Intergenic
945516653 2:210770823-210770845 TTGAATAGGAGTGGTTAGAGAGG - Intergenic
945576009 2:211529948-211529970 CTGAATAACAATGGTGAGGGTGG - Intronic
945579690 2:211577914-211577936 TTGAATAGGAATGATGAGAGAGG - Intronic
945615309 2:212058894-212058916 TTGAATAAGAGTGATGAGAGAGG - Intronic
945719627 2:213403660-213403682 TTGAATAGGAATGATGAGAGGGG - Intronic
945927790 2:215823427-215823449 TTGAATAGGAGTGATGAGAGAGG - Intergenic
946435986 2:219654416-219654438 TTGAATAAGAGTGGTAAGAGAGG - Intergenic
946511363 2:220360370-220360392 TTGAATAGGAGTGATGAGAGAGG + Intergenic
946945052 2:224812524-224812546 TTGAATAGGAGTGGTGAGGGAGG + Intronic
946983835 2:225249134-225249156 TAGAAAAAGAATGATTTGGCCGG - Intergenic
947086397 2:226457816-226457838 TTGAATAGGAATGGTGAGAGAGG - Intergenic
947198287 2:227591258-227591280 TTGAATAGGAATGGTGAGAGAGG + Intergenic
947387187 2:229602926-229602948 TTGAATAAGAACAATGTGGGAGG + Intronic
947449332 2:230192238-230192260 TTGAATAGGAATGGTGAGAGAGG - Intronic
948113464 2:235475760-235475782 TTGAATAGGAATGGTGAGAGTGG + Intergenic
1168933126 20:1640646-1640668 TTGAATAGAAATGGTTAGAGAGG + Intronic
1170054688 20:12188404-12188426 TTGAATAGGAGTGGTTAGAGTGG + Intergenic
1170103987 20:12733827-12733849 TGGAATAGGCATGCTTAGGGAGG - Intergenic
1170146103 20:13176283-13176305 TTGAATAAGAGTGGTGAGAGTGG + Intergenic
1170832263 20:19852680-19852702 TAGATTAAGAATGATCAGAGAGG - Intergenic
1171000626 20:21411983-21412005 TTGAATAAGAGTGATGAAAGTGG + Intergenic
1171060953 20:21959472-21959494 TTGAATACAAATGATGAGAGTGG + Intergenic
1171238839 20:23548919-23548941 TTGAATAAAAAAGATTAAAGTGG + Intergenic
1171356947 20:24554343-24554365 TTGAATAGGAGTGATGAGAGAGG + Intronic
1171441794 20:25170042-25170064 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1171740538 20:28880334-28880356 GTGAATAAGAATGCTTAAAGTGG + Intergenic
1171772486 20:29334556-29334578 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1171775968 20:29368094-29368116 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1171778786 20:29398158-29398180 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1171816935 20:29794143-29794165 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1171913476 20:30989417-30989439 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1173038712 20:39439013-39439035 TTGAGTAAGAATGATGAGAGTGG + Intergenic
1173286220 20:41673575-41673597 TTGCATAAAGAAGATTAGGGTGG + Intergenic
1174694907 20:52547350-52547372 TTGAATAGGAATGGTGAGGGAGG - Intergenic
1174929643 20:54798901-54798923 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1174992707 20:55529450-55529472 TTGAATGAGAAAGTTTAGGATGG + Intergenic
1176174634 20:63714122-63714144 TTGAATAAAAGTGACTAGAGCGG + Intronic
1176325391 21:5443856-5443878 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1176344090 21:5725092-5725114 TTGAATAGGAGTGCTGAGGGAGG + Intergenic
1176403737 21:6342606-6342628 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1176433420 21:6646498-6646520 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1176500737 21:7599364-7599386 TTGAATAGGAGTGCTGAGGGAGG - Intergenic
1176538411 21:8123161-8123183 TTGAATAGGAGTGCTGAGGGAGG + Intergenic
1176598415 21:8769481-8769503 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1176716217 21:10351707-10351729 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1176814955 21:13590744-13590766 TTGAATAAGAATGGTGAGAAAGG - Intergenic
1176995887 21:15554831-15554853 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1177043617 21:16143569-16143591 TTGGATAGGAATGATGAGAGAGG + Intergenic
1177090184 21:16758193-16758215 TTGAATAAGAGTGGTAAGAGAGG - Intergenic
1178033891 21:28559072-28559094 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1178210192 21:30521621-30521643 TTGAATTAGAATGATAAGAAAGG + Intergenic
1179131288 21:38639443-38639465 TTGAATAAAAAGGATCAGAGAGG + Intronic
1179336609 21:40462551-40462573 TGGAATTAGAATGCTTAGGCAGG + Intronic
1179439217 21:41381382-41381404 TTGGGTAAGAATGAATAGTGAGG + Intronic
1179930005 21:44561934-44561956 TTGAATAGGAGTGATGAGAGAGG - Intronic
1180323438 22:11345506-11345528 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1180420029 22:12805420-12805442 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1180541610 22:16453998-16454020 TTGAATAAGAATGGTGAGAGAGG - Intergenic
1180602120 22:17028228-17028250 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1181357864 22:22312412-22312434 TTGAATAAAAGTGATGAGGCTGG + Intergenic
1182167952 22:28195389-28195411 TTGAATAGGAATGGTGAGAGAGG - Intronic
1182169557 22:28213232-28213254 TTGAATAGGAATGGTGAGAGAGG - Intronic
1182934071 22:34204112-34204134 TTGAATAGAAATGACTAGAGCGG - Intergenic
1184001453 22:41677226-41677248 GTTAATAAGAATGATGAGGCTGG + Intronic
949466297 3:4347636-4347658 TTGAATAAGAGTGGTGAGAGAGG - Intronic
949664261 3:6318859-6318881 TTGAATAGGAGTGGTTAGAGAGG - Intergenic
949712640 3:6889269-6889291 TTGAATAGGAGTGATGAGAGAGG + Intronic
950608012 3:14101450-14101472 TTGAATAGGAATGGTTAGAGTGG - Intergenic
950960326 3:17098615-17098637 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
950998553 3:17530937-17530959 TTGAATAAGAGTGGTGAGAGAGG - Intronic
951189498 3:19751863-19751885 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
951196818 3:19833331-19833353 TTGAATAAGAGTGATGACAGTGG + Intergenic
951261061 3:20509424-20509446 TTGAATAGGAATGGTGAGAGAGG + Intergenic
951284984 3:20799817-20799839 TTGAATAAGAATGATGACAGTGG + Intergenic
951311279 3:21128981-21129003 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
951452570 3:22855651-22855673 TTGAATAGGAATGGTGAGAGAGG + Intergenic
951623653 3:24635296-24635318 TTGAATAGGAATGCTGAGAGAGG + Intergenic
951628688 3:24695153-24695175 TTGAATAGGAATGCTGAGAGAGG + Intergenic
952030552 3:29137108-29137130 ATGAATAAGAGTGGTTAGGAAGG + Intergenic
952572104 3:34730223-34730245 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
952616742 3:35282354-35282376 TTGAATAGGAATGGTGAGAGAGG - Intergenic
952638497 3:35561591-35561613 TTGAATAGAAATGATCAGGGTGG - Intergenic
952679141 3:36071053-36071075 TTGAATAGGTATGATGAGAGAGG + Intergenic
952680586 3:36086826-36086848 TTGAATAGGAGTGATGAGAGAGG - Intergenic
952694946 3:36254013-36254035 TTGAATAGGAGTGATGAGAGAGG - Intergenic
952735445 3:36686731-36686753 TTGAAACAGAATGATGAGAGGGG - Intergenic
952813635 3:37427392-37427414 TTGAATAGGAATGGTGAGCGAGG + Intronic
952842219 3:37656728-37656750 TTGAATAGGAGTGATGAGCGAGG + Intronic
953080937 3:39617032-39617054 TTGAATAGGAATGGTGAGAGAGG + Intergenic
953316242 3:41929445-41929467 TTGAATAGGAATGGTGAGAGAGG - Intronic
953555388 3:43942049-43942071 TTGAATAGGAGTGATGAGAGAGG + Intergenic
954517641 3:51192953-51192975 TTGAATAGGAATGGTGAAGGTGG + Intronic
955174359 3:56598452-56598474 TTGAATAAGAATGGTGAAAGTGG + Intronic
955256881 3:57341198-57341220 TTGAATAAGAGTGATGAGAGTGG - Intronic
955886389 3:63603381-63603403 TTGAATAGGAGTGGTTAGAGAGG + Intronic
956051653 3:65254807-65254829 TTGAATAGGAGTGGTTAGAGAGG + Intergenic
956355054 3:68381808-68381830 TTGAATAGGAGTGATGAGAGAGG + Intronic
956569453 3:70677711-70677733 TTGAATAGGAATGGTGAGAGAGG + Intergenic
956918710 3:73903351-73903373 CTAAATAAAAATGATTAGGGTGG - Intergenic
956993640 3:74798294-74798316 TTGAATAGGAGTGATGAGAGAGG - Intergenic
957005004 3:74934718-74934740 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
957092782 3:75748794-75748816 TTGAATAGGAGTGATGAGAGAGG - Intronic
957338652 3:78864124-78864146 ATGAATAGGATTGATTAGTGTGG - Intronic
957395133 3:79626603-79626625 TTGAATAGGAGTGATGAGAGAGG - Intronic
957441189 3:80250215-80250237 TTGAATAAGAGTGGTAAGAGAGG - Intergenic
957598986 3:82307681-82307703 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
957640291 3:82844756-82844778 TTGAATAGGAGTGATGAGAGAGG - Intergenic
957644736 3:82906478-82906500 TTGAATAGGAATGGTGAGAGAGG + Intergenic
957750213 3:84405109-84405131 TTGAATAGGAGTGATGAGAGAGG + Intergenic
957815658 3:85293892-85293914 TTGAATAGGAGTGGTGAGGGAGG - Intronic
957871664 3:86097045-86097067 TTGAATAGGAGTGATGAGAGAGG - Intergenic
957890443 3:86350515-86350537 TTGAATAACAGTGGTTAGAGTGG + Intergenic
957915125 3:86678712-86678734 TTGAATCAGAATGGTGAGAGTGG + Intergenic
957951536 3:87133600-87133622 TTGAATAAGAGTGATGAGAGAGG + Intergenic
957992237 3:87641009-87641031 TTGAATAAGAGTCATGAGAGTGG + Intergenic
958125283 3:89347652-89347674 TTGAATAAGAGTGGTGAGAGAGG + Intronic
958171079 3:89941125-89941147 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
958204418 3:90371409-90371431 TTGAATAGGAGTGGTTTGGGAGG + Intergenic
958255127 3:91316667-91316689 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
958485235 3:94697610-94697632 TTTTATAAGAATGAATAGGCCGG + Intergenic
958527719 3:95284982-95285004 TTGAATAGGAGTGGTTAGAGAGG + Intergenic
958586617 3:96095329-96095351 TTGAATAGGAGTGATGAGAGAGG - Intergenic
958605933 3:96358474-96358496 TTGAATAGGAATGAGGTGGGAGG + Intergenic
958624162 3:96603373-96603395 TTGAATAAGAGTGGTGAGGGAGG + Intergenic
958706638 3:97664424-97664446 TTGAATAGGAGTGGTGAGGGAGG - Intronic
958998269 3:100931299-100931321 TTGAATAGGAATGGTGAGAGTGG - Intronic
959046026 3:101474716-101474738 TTGAATAAGAGTGATGACAGTGG + Intronic
959097052 3:101967428-101967450 TTGAATAGGAGTGATGAGAGAGG + Intergenic
959176686 3:102921653-102921675 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
959285155 3:104399247-104399269 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
959301556 3:104608691-104608713 TTGAATAGGAGTGATGAGAGAGG - Intergenic
959326901 3:104948364-104948386 TTGAATAGGAGTGATGAGAGAGG + Intergenic
959522665 3:107337807-107337829 TTGAATAGGAATGGTGAGAGAGG - Intergenic
959556494 3:107725446-107725468 TTGAATAGGAATGGTGAGAGAGG + Intronic
959762777 3:109987992-109988014 TTGAGTAAGAATCATGAGGCCGG + Intergenic
959826896 3:110807961-110807983 TTTAATAAGAAAGAGTAAGGAGG + Intergenic
959828624 3:110832890-110832912 TTGAATAGGAGTGGTAAGGGAGG + Intergenic
959953165 3:112205005-112205027 TTGAATAGGAATGGTGAGAGAGG - Intronic
959954086 3:112215312-112215334 TTGAATAGGAATGGTGAGAGAGG - Intronic
960017169 3:112904566-112904588 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
960018328 3:112918466-112918488 TTGAATAGGAGTGATGAGAGAGG - Intergenic
960112349 3:113857232-113857254 TTGAATAAGAACGGTGAGAGTGG + Intronic
960414089 3:117362798-117362820 TTGAATAGGAATGATGAGAGAGG - Intergenic
960874163 3:122280309-122280331 TTGAATAAGAGTGGTGAGAGCGG - Intronic
961895322 3:130162479-130162501 TTGAATAGGAGTGATGAGAGGGG + Intergenic
961909002 3:130295017-130295039 TTGAATAGGAGTGATTAGAGAGG - Intergenic
961985644 3:131130473-131130495 TTGAAAATAAATGATTAGAGGGG + Intronic
961997860 3:131265252-131265274 TTGAATAGGAGTGATGAGAGAGG + Intronic
962015575 3:131436674-131436696 TTGAATAAGAATGCTGACAGTGG - Intergenic
962338037 3:134555226-134555248 TTGAATAGGAGTGATGAGAGAGG - Intronic
962513855 3:136130119-136130141 TTGAATAGGAGTGGTTAGAGAGG - Intronic
962592083 3:136900949-136900971 TTGAATAGGAGTGATTAAAGTGG + Intronic
962599205 3:136977990-136978012 TTGAATAAGAGTGGTAAGAGTGG + Intronic
962656337 3:137547739-137547761 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
962863263 3:139424264-139424286 TTGAATAAGAGTGATGAGAGTGG - Intergenic
963048189 3:141119528-141119550 TTGAATAGGAGTGATGAGAGAGG + Intronic
963109429 3:141674279-141674301 TTGAATAGGAGTGATGAGAGAGG - Intergenic
963282100 3:143394556-143394578 TTGAATAAGAGTGGTGAGAGAGG - Intronic
963443054 3:145365678-145365700 TTGAATAGGAGTGATGAGAGTGG + Intergenic
963450735 3:145479040-145479062 TTGAATAGGAATGGTGAGAGAGG + Intergenic
963477294 3:145823307-145823329 TTGAATAGGAGTGATGAGAGAGG + Intergenic
963493480 3:146030639-146030661 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
963587238 3:147207699-147207721 TTGAATAGGAGTGATGAGAGAGG + Intergenic
964053526 3:152424032-152424054 TTGAATAGGAGTGGTGAGGGAGG - Intronic
964070872 3:152631615-152631637 TTGAATAGGAGTGATGAGAGAGG + Intergenic
964089219 3:152853651-152853673 TTGAATAAGAGTGGTAAGAGAGG - Intergenic
964189482 3:153985438-153985460 TTGAATAGGAGTGATGAGAGAGG + Intergenic
964190786 3:153998712-153998734 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
964228563 3:154435618-154435640 TTGAATAGGAATGGTGAGAGAGG + Intergenic
964244446 3:154634712-154634734 TTGAATAGGAGTGATGAGAGTGG + Intergenic
964270394 3:154949249-154949271 TTGAATAGGAGTGATGAGAGAGG - Intergenic
964460228 3:156916793-156916815 TTGAATAAGAGTAATGAGAGAGG + Intronic
964564818 3:158038233-158038255 TTGAATAGGAATGGTGAGAGAGG - Intergenic
964783117 3:160362971-160362993 TTGAATAGGAATGGTGAGAGAGG - Intronic
965025841 3:163300650-163300672 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
965085932 3:164098248-164098270 TTGAATAAGAGTGGTGAGGGTGG + Intergenic
965318366 3:167219748-167219770 ATAAATAATAATGATTAGAGAGG + Intergenic
966341127 3:178925924-178925946 TTGAATAAGAATGGTGAGAGAGG - Intergenic
966574263 3:181481729-181481751 TTGAATAGGAATGGTGAGAGAGG - Intergenic
967255182 3:187584053-187584075 TTGAATAGGAATGATGAAAGAGG + Intergenic
968696087 4:2028551-2028573 TTGAATAAGAGTGATGAGAGAGG + Intronic
968885242 4:3326124-3326146 TTGAATAGGAGTGATGAGAGTGG - Intronic
969180931 4:5440642-5440664 TTGAATAAGAGTGGTGAGAGAGG + Intronic
969698659 4:8752318-8752340 TTGAATAGGAATGGTGAGAGAGG - Intergenic
969952274 4:10850172-10850194 TTGAATAGGAGTGGTAAGGGAGG + Intergenic
970107338 4:12599563-12599585 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
970155045 4:13133226-13133248 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
970175421 4:13334616-13334638 TTGAATAGGAATGGTGAGAGAGG + Intergenic
970358543 4:15282616-15282638 TTGAATAGGAGTGATGAGAGAGG - Intergenic
970555590 4:17228495-17228517 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
970800513 4:19967297-19967319 TTGAATAAAAATAGTTAGAGTGG + Intergenic
970917829 4:21356274-21356296 TTGAATAGGAATGGTGAGAGAGG - Intronic
971107672 4:23544478-23544500 TTGAATAGGAATGATGAGAGAGG - Intergenic
971186833 4:24386345-24386367 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
971270172 4:25136157-25136179 TTGAATAAGAGTGGTGAGAGAGG - Intronic
971583549 4:28375241-28375263 TTGAATGAAAAAGATTAGTGTGG + Intronic
971704220 4:30018478-30018500 TTCATAAAGAATGATTAGGTAGG + Intergenic
971772022 4:30909284-30909306 TTGAATAGGAATGGTGAGAGAGG - Intronic
971903357 4:32693409-32693431 TATAGTAAGAATGATGAGGGAGG + Intergenic
971919065 4:32913006-32913028 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
972215006 4:36887635-36887657 TTGAATAAGAGTGATAAGAGTGG + Intergenic
972256165 4:37357977-37357999 TAGAACAAGTATGAATAGGGAGG + Intronic
972261413 4:37412088-37412110 TTGAATAGGAGTGATGAGAGAGG - Intronic
972660811 4:41114425-41114447 TTGAATACGAGTGATGAGAGAGG - Intronic
972811596 4:42594160-42594182 TTAAATAAAAATTATTAGAGAGG + Intronic
972858749 4:43140648-43140670 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
972861242 4:43171364-43171386 TTGAATAAGAGTGGTAAGAGAGG - Intergenic
972892922 4:43581994-43582016 TTGAATAGGAATGGTGAGTGAGG + Intergenic
972896720 4:43630954-43630976 TTAAATAAGAATGTCTGGGGTGG + Intergenic
972929178 4:44050226-44050248 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
973013522 4:45107288-45107310 TTGAATAGGAGTGATGAGAGAGG + Intergenic
973064737 4:45774522-45774544 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
973132429 4:46664192-46664214 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
973254837 4:48099625-48099647 CTGAAAAAGAATAATGAGGGAGG + Intronic
973322187 4:48821499-48821521 TTAAATAGGAATGATGAGAGAGG - Intronic
973361744 4:49171847-49171869 TTGAATAGGAGTGATGAGAGAGG + Intergenic
973567917 4:52207022-52207044 TTGAATAGGAGTGATGAGAGAGG + Intergenic
973654688 4:53034427-53034449 TTGAATAGGAGTGGTTAGAGTGG - Intronic
973669657 4:53203064-53203086 TTGAATAGGAGTGGTGAGGGAGG + Intronic
973921854 4:55694902-55694924 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
974119464 4:57621373-57621395 TTGAATAGGAATGGTGAGAGAGG + Intergenic
974182099 4:58397713-58397735 TTGAATAGGAGTGATGAGAGAGG + Intergenic
974239902 4:59233538-59233560 TTGAATAAGAGTGATAAGGGAGG + Intergenic
974252251 4:59401632-59401654 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
974263592 4:59556504-59556526 TTGAATAGGAATGGTGAGAGAGG + Intergenic
974288155 4:59896067-59896089 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
974330028 4:60466381-60466403 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
974359004 4:60851727-60851749 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
974370931 4:61015732-61015754 TTGAATAGGAATGGTGAGAGAGG - Intergenic
974454342 4:62106810-62106832 TTGAATCAGAGTGGTGAGGGAGG + Intergenic
974560443 4:63510023-63510045 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
974562836 4:63543584-63543606 TTAAATAAGAATGATGAGAGTGG - Intergenic
974689245 4:65273648-65273670 TTGAATAGGAATGGTGAGAGAGG + Intergenic
974741199 4:66010242-66010264 TTGAATAGGAGTGATGAGAGAGG + Intergenic
974791557 4:66696435-66696457 TTGAATGAGAATTATAATGGAGG + Intergenic
974898565 4:67969453-67969475 TTGAATAGGAGTGATGAGAGAGG + Intergenic
974947493 4:68545718-68545740 TGGAATAAAAATGATTAAGGGGG + Intronic
975036241 4:69686447-69686469 TTGAATAAGAGTGATGAGAGAGG + Intergenic
975036652 4:69692768-69692790 TTGAATAGGAGTGATGAGAGTGG + Intergenic
975194586 4:71509206-71509228 TTGAATAAGAATGGTGAGACAGG - Intronic
975203615 4:71619895-71619917 TTGAATAGGAGTGATGAGAGAGG - Intergenic
975297937 4:72755483-72755505 TTGAATAGGAATGGTGAGAGAGG - Intergenic
975301929 4:72800270-72800292 TTGAATAGGAGTGATGAGAGAGG - Intergenic
975389011 4:73794750-73794772 TTGAATAGGAATGGTAAGAGAGG - Intergenic
975792741 4:77972126-77972148 TTGAATAGGAATGGTGAGAGGGG - Intergenic
975932618 4:79543906-79543928 TTGAATATGAATGGTAAGAGTGG + Intergenic
975933102 4:79550901-79550923 TTGAATAGAAATGATTAAAGGGG - Intergenic
976116089 4:81728610-81728632 TTGAATAAAAGTGATTAAAGTGG - Intronic
976161554 4:82205870-82205892 TTGAATAACAATGGTGAGAGTGG - Intergenic
976355745 4:84115583-84115605 TTGAATAGGAGTGATGAGAGAGG + Intergenic
976451014 4:85191050-85191072 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
976994651 4:91415449-91415471 TTGATTAAGCATGGTAAGGGAGG + Intronic
977002667 4:91522911-91522933 TTGAATAAGAGTGGTGAGAGAGG + Intronic
977213087 4:94243860-94243882 TTGAACCAGAATGCTTAGGTAGG - Intronic
977273886 4:94951310-94951332 TTGAATAGGAATGGTGAGAGAGG + Intronic
977274855 4:94964360-94964382 TTGAATAAGAATGGTAAAAGTGG + Intronic
977410596 4:96657175-96657197 TTGAATAAGAGTGGTGAGAGTGG - Intergenic
977418014 4:96759932-96759954 TTGAATAGGAGTGATTAAAGTGG + Intergenic
977479919 4:97562479-97562501 TTGAATAGGAGTGGTGAGGGAGG + Intronic
977815309 4:101407703-101407725 TTGAATAGGAATGGTGAGAGAGG + Intergenic
977896048 4:102366300-102366322 TTGAATAGAAATGATGAGAGAGG - Intronic
978140177 4:105309277-105309299 TTGAATAGGAATGGTGAGAGAGG + Intergenic
978175882 4:105731730-105731752 TTGAATAGGAGTGATGAGAGAGG + Intronic
978196765 4:105981100-105981122 TTGAATAGGAGTGATGAGAGAGG + Intronic
978238559 4:106489389-106489411 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
978505974 4:109456428-109456450 TTGAATAGGAATGATGAGAGAGG + Intronic
978600368 4:110420903-110420925 TTGAATAGGAATGGTGAGAGAGG - Intronic
978609293 4:110519639-110519661 TTGAATAATAATGATGATGATGG - Intronic
978678383 4:111347416-111347438 TTGAATAAGAGTGATGAAAGTGG + Intergenic
978929283 4:114291137-114291159 TTGAATAGGAATGGTGAGAGAGG - Intergenic
979009670 4:115351677-115351699 TTGAATAGGAATGGTGAGAGAGG + Intergenic
979012684 4:115391359-115391381 TTGAATAGGAATGATGAGGGAGG - Intergenic
979017094 4:115448664-115448686 TTGAATAGGAATGGTGAGAGAGG + Intergenic
979048620 4:115901599-115901621 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
979064373 4:116109818-116109840 TTGAATAGGAGTGATGAGAGTGG - Intergenic
979134277 4:117089425-117089447 TTCCATATGAATCATTAGGGAGG - Intergenic
979141797 4:117184691-117184713 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
979176354 4:117668687-117668709 TTGAATAGGAATGGTGAGAGAGG + Intergenic
979179878 4:117711774-117711796 TTGAATAGGAGTGATGAGAGAGG - Intergenic
979185611 4:117788194-117788216 TTGAATAAGAGTGGTGAGAGTGG + Intergenic
979198857 4:117952546-117952568 TTGAATAGGAGTGATGAGAGAGG - Intergenic
979591657 4:122487958-122487980 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
979729787 4:124010427-124010449 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
979758368 4:124370007-124370029 TTTAATAAGAGTGATGAGAGTGG + Intergenic
980395515 4:132208785-132208807 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
980561450 4:134481863-134481885 TTGAATAAGGATGGTGAGCGAGG + Intergenic
980607387 4:135110653-135110675 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
980665617 4:135929877-135929899 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
981036429 4:140174318-140174340 TTGAAAAAGAATGAATTGGGAGG - Intergenic
981181237 4:141748020-141748042 TTGAATAAGAGTGGTGAGAGTGG - Intergenic
981233157 4:142382881-142382903 TTGAATAATAATGATGATAGTGG + Intronic
981285543 4:143014574-143014596 TTAAATAAGAGTGACTAGAGTGG + Intergenic
981338186 4:143590275-143590297 TTGAATAGGAGTGATGAGAGAGG + Intronic
981395230 4:144239409-144239431 TTGAATAGGAGTGATGAGAGAGG + Intergenic
981415351 4:144486534-144486556 TTGAATAGGAATGGTGAGAGAGG - Intergenic
981738690 4:147980070-147980092 TTGAATAGGAATGGTGAGAGTGG + Intronic
981879603 4:149593494-149593516 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
981939643 4:150268847-150268869 TTGGATAAGAGTGATTAAAGTGG - Intronic
981958418 4:150506681-150506703 TTGAATAAGAGTGGTGAGAGAGG - Intronic
981984352 4:150835839-150835861 TTGAATAAGAGTGGTGAGAGAGG + Intronic
982290411 4:153775830-153775852 TTGAATAAGAATGGAGAGAGTGG + Intergenic
982295036 4:153819332-153819354 TTGAATAGGAGTGATGAGAGAGG - Intergenic
982499467 4:156134979-156135001 TTGAATAGGAGTGATGAGAGAGG - Intergenic
982524862 4:156466123-156466145 TTGAATAGGAATGGTGAGAGAGG - Intergenic
982579460 4:157159369-157159391 TTGAATAGGAATGCTAAGAGAGG + Intronic
982614527 4:157623927-157623949 TTGAATAGGAGTGGTTAGAGAGG - Intergenic
982690879 4:158546488-158546510 TTGAATAGGAATGGTGAGAGAGG + Intronic
982792687 4:159611454-159611476 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
982843083 4:160217476-160217498 TTGAATAAGAGTGATGAGAGTGG + Intergenic
983010952 4:162546461-162546483 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
983048819 4:163019810-163019832 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
983148386 4:164245553-164245575 TTGAATAAGAGTGCTAAGAGAGG - Intronic
983172051 4:164547319-164547341 TTGAATAAGAGTGGTGAGGGAGG - Intergenic
983174032 4:164567196-164567218 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
983329069 4:166301322-166301344 TTTAAAAGGAATGAGTAGGGGGG + Intergenic
983339507 4:166440732-166440754 TTGAATAGGAGTGATGAGAGTGG + Intergenic
983355222 4:166648279-166648301 TTGAATAAGAGTGATGAGAAGGG + Intergenic
983402742 4:167286000-167286022 TTGAATAGGAGTGATGAGAGAGG + Intergenic
983407166 4:167345554-167345576 TTGAATAGGAGTGATGAGAGAGG + Intergenic
983418583 4:167489193-167489215 TTGAATAAGAATGGTGAGAGAGG + Intergenic
983478023 4:168239928-168239950 TTGAATAAGAGTGGTGAGAGAGG - Intronic
984001091 4:174246079-174246101 TTGGATAAGAAGGATTAGTAAGG + Intronic
984046408 4:174804885-174804907 CTGCATAATAAAGATTAGGGTGG - Intronic
984066337 4:175052614-175052636 TGGAATAAGACTGTTTAGAGAGG + Intergenic
984076019 4:175180879-175180901 TTGAATAGGAGTGATGAAGGAGG + Intergenic
984172256 4:176373498-176373520 CTGAATAAGAATGGTTAAAGTGG - Intergenic
984216173 4:176915124-176915146 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
984217912 4:176937054-176937076 TTGAATAGGAATGGTGAGAGAGG + Intergenic
984283075 4:177695971-177695993 TAGATTAAGAATGATTAGGTCGG + Intergenic
984457242 4:179985892-179985914 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
984482576 4:180324848-180324870 TTGAATAGGAATGGTGAGAGAGG + Intergenic
984485290 4:180360401-180360423 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
985157363 4:187003528-187003550 TTGAATAAGAATGGTGAGAGAGG - Intergenic
985221320 4:187708389-187708411 TTGAATAAAAATGATGAAAGTGG - Intergenic
985332354 4:188852052-188852074 TTGAATAAGAGTGATAAAAGTGG + Intergenic
985340392 4:188946414-188946436 TTGAATAAGAGTCATGAGAGAGG - Intergenic
985368416 4:189259268-189259290 TTGAATAAGAGTGGTGAGAGTGG + Intergenic
986277567 5:6291688-6291710 TTGAATAGGAATGGTGAGAGAGG - Intergenic
986463840 5:8001062-8001084 TTGAATAAGAATGGCAAGAGTGG + Intergenic
986501497 5:8405281-8405303 TTGAATAAAAGTGGTTAGAGGGG + Intergenic
986549932 5:8941312-8941334 TTGAATAGGAATGGTAAGAGAGG - Intergenic
986665107 5:10095410-10095432 TTGAATAGGAATGGTGAGAGAGG - Intergenic
986898273 5:12397788-12397810 CTGAATAAGAGTGATGAGAGTGG - Intergenic
987152074 5:15052597-15052619 TTGAATAGTAATGATGAGAGTGG + Intergenic
987223298 5:15813167-15813189 TTGAATAGGAGTGGTGAGGGAGG + Intronic
987430241 5:17824181-17824203 TTGAATAAGAGTGATGAGGGAGG - Intergenic
987434039 5:17871738-17871760 TAGAATAAAAGTGATTAGAGTGG - Intergenic
987838350 5:23190115-23190137 TTGAATAGGAGTGATGAGAGAGG - Intergenic
987885626 5:23807849-23807871 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
987962527 5:24828621-24828643 TTGAATAGGAATGGTGAGAGAGG - Intergenic
988118336 5:26926045-26926067 TTGAATAGGAATGGTGAGAGAGG - Intronic
988118988 5:26935340-26935362 TTGAATAGGAGTGATTAAGAGGG - Intronic
988140960 5:27239590-27239612 TTGAATAAGAGTGGTAAGAGTGG + Intergenic
988305990 5:29494747-29494769 TTGAATAGGAATGGTGAGAGAGG + Intergenic
988626457 5:32880673-32880695 TTGAATAAGAGTGGTGAGGGTGG + Intergenic
988651393 5:33155616-33155638 TTGAATGGGAGTGATTAGAGTGG - Intergenic
988975536 5:36512132-36512154 TTGAATAAGAGTGGTGAGGGAGG - Intergenic
989248207 5:39277773-39277795 TTGAATAGGAATGGTGAGAGAGG + Intergenic
989303615 5:39925392-39925414 TTCTGTAAGAATGATTAGAGAGG - Intergenic
989461620 5:41705949-41705971 TTGAATAGGAATGGTGAGAGTGG + Intergenic
989683865 5:44061927-44061949 TTGAATAGGAATGGTGAGAGAGG + Intergenic
989771012 5:45145360-45145382 TTGAATAGGAATGGTGAGAGTGG + Intergenic
989941821 5:50160088-50160110 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
989970355 5:50516764-50516786 TTGAATAAGAGTGGTGAGAGTGG + Intergenic
989991950 5:50775932-50775954 TTGAATAAGAGTGGTGAAGGTGG + Intronic
990084340 5:51955887-51955909 TTGAATAGGAGTGATGAGAGAGG - Intergenic
990107234 5:52279505-52279527 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
990183352 5:53187061-53187083 TTGAATAGGAGTGATGAGAGAGG + Intergenic
990195208 5:53307163-53307185 TTGAATAGGAGTGATGAGAGAGG + Intergenic
990655016 5:57945388-57945410 TTGAATAGGAATGGTGAGAGAGG + Intergenic
991282862 5:64936137-64936159 TTGAATAGGAATGATGAGAGAGG + Intronic
991324672 5:65417332-65417354 TTGAATAGGAATGGTGAGAGTGG - Intronic
991346847 5:65677944-65677966 TTGAATAGGAGTGATGAGAGAGG - Intronic
991537539 5:67688098-67688120 TTAAATAATAATGATTAGAGTGG + Intergenic
991782121 5:70148694-70148716 TTGAATAGGAGTCATGAGGGAGG - Intergenic
991844436 5:70844530-70844552 TTGAATAGGAGTCATGAGGGAGG + Intergenic
991874564 5:71149009-71149031 TTGAATAGGAGTCATGAGGGAGG - Intergenic
992002380 5:72448540-72448562 TTGGACAAGAATGTTAAGGGAGG + Intronic
992032080 5:72731693-72731715 TTGAATAGGAATGGTGAGAGAGG - Intergenic
992054862 5:72978646-72978668 TTGAATAAGAGTGGTGAGAGAGG + Intronic
992265505 5:75014245-75014267 TTGAATAGGAGTGATGAGAGAGG - Intergenic
992340737 5:75820749-75820771 TTGAATAGGAATGGTGAGAGAGG - Intergenic
992545234 5:77807793-77807815 TTGAATAAGAGTGATGAAAGTGG + Intronic
992755988 5:79906393-79906415 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
993053086 5:82948114-82948136 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
993089855 5:83411862-83411884 TTGAATAGGAATGGTGAGAGAGG - Intergenic
993093848 5:83459840-83459862 TTGAATAGGAATGGTGAGAGAGG + Intergenic
993122702 5:83795650-83795672 TTGAATAGGAATGGTGAGAGAGG + Intergenic
993194084 5:84718458-84718480 TTGAATAGGAGTGATGAGAGAGG - Intergenic
993420334 5:87693737-87693759 TTGAATAGGAATGATGAGAGAGG + Intergenic
993474035 5:88342862-88342884 TTGAATAAGAATGGTAAGAGTGG + Intergenic
993544655 5:89196351-89196373 TTGAATAGGAGTGATGAGAGAGG + Intergenic
993564979 5:89462914-89462936 TTATATAGGAATGATTAGGAGGG + Intergenic
993621805 5:90177439-90177461 TTGAATAGGAGTGATGAGAGAGG - Intergenic
993985019 5:94587146-94587168 TTGAATAGGAGTGATGAGAGAGG - Intronic
993995473 5:94717475-94717497 TTGAATAGGAGTGATGAGAGAGG - Intronic
994004696 5:94824082-94824104 TTGAATAGGAATGGTGAGAGAGG + Intronic
994119623 5:96099362-96099384 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
994236014 5:97363230-97363252 TTGAATAAAAGTGGTTAGAGAGG - Intergenic
994355525 5:98790273-98790295 TTGAATCAAAATGCTGAGGGGGG - Intronic
994400033 5:99267065-99267087 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
994405604 5:99341652-99341674 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
994424827 5:99572076-99572098 TTGAATAGGCATGGTGAGGGTGG - Intergenic
994470279 5:100195056-100195078 TTGAATAGGAATGATAAGAGGGG - Intergenic
994545992 5:101166947-101166969 TTGAATAGGAATGGTGAGAGAGG - Intergenic
994585699 5:101706599-101706621 TTGAATGAGAATGGTAAGAGTGG + Intergenic
994624647 5:102203363-102203385 TTGAATAGGAATGGTGAGAGAGG - Intergenic
994629475 5:102266339-102266361 TTGAATAAGAGTGATGAAAGTGG + Intronic
994642732 5:102430341-102430363 TTGAATAGGAATGGTGAGAGGGG + Intronic
994785073 5:104149138-104149160 TTGAATAGGAGTGGTTAGAGAGG - Intergenic
994978286 5:106839746-106839768 TTGAATAGGAATGGTGAGAGAGG + Intergenic
995178797 5:109210532-109210554 TTGAATAGGAATGGTGAGAGAGG + Intergenic
995307443 5:110670085-110670107 TTGAATAAGAGTGGTGAGAGAGG - Intronic
995329336 5:110929567-110929589 TTGAATAAGAGTGGTAAGAGAGG + Intergenic
995578681 5:113571017-113571039 TTGAATAAGAGTGATGAGAGAGG + Intronic
995664375 5:114524697-114524719 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
995692365 5:114841893-114841915 TTGAATAGGAATGGTGAGAGAGG - Intergenic
995695168 5:114870849-114870871 TTGAATAGGAGTGATAAGAGAGG - Intergenic
995711786 5:115043053-115043075 TTGAATAGGAGTGATGAGAGAGG - Intergenic
996211250 5:120813779-120813801 TTGAATAAGAATCGTGAGAGTGG + Intergenic
996231422 5:121068180-121068202 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
996280325 5:121722411-121722433 TTGAATAGGAATGGTGAGAGAGG + Intergenic
996360963 5:122645752-122645774 TTGAATAAGAATGGTGAATGTGG - Intergenic
996426263 5:123316567-123316589 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
996462834 5:123766790-123766812 TTGAATAGGAATGGTGAGAGAGG + Intergenic
996625922 5:125570299-125570321 TTGAATAGGAGTGATGAGAGAGG - Intergenic
996851269 5:127955652-127955674 TTGAATAAGAATGGTGAGACTGG - Intergenic
996902443 5:128558022-128558044 TTGAATAGGAGTGATGAGAGAGG - Intronic
997142773 5:131400416-131400438 TTAAACAAGAAGGATTAGGGGGG + Intergenic
997797480 5:136825051-136825073 TTGAATAGGAGTGATGAGAGAGG + Intergenic
997802434 5:136878802-136878824 TTGAATAGGAGTGGTGAGGGTGG - Intergenic
997876316 5:137550937-137550959 TTGAATAAGAATGGTGAGAGAGG - Intronic
998247312 5:140518889-140518911 TTGAATAAGAGTGGTGAGAGAGG - Intronic
998683897 5:144502601-144502623 TTCTAAAAGAAAGATTAGGGAGG - Intergenic
998688660 5:144560421-144560443 TTGAATAGGAATGGTGAGAGAGG - Intergenic
998774463 5:145583394-145583416 TTGAATAGGAATGGTGAGAGAGG - Intronic
999066395 5:148691044-148691066 TTGAATAGGAGTGATGAGAGTGG - Intergenic
999413678 5:151376031-151376053 TTGAATAGGAATGGTGAGAGTGG + Intergenic
999549265 5:152666802-152666824 TTGAATAGAAATGATGAGAGTGG - Intergenic
999556409 5:152747418-152747440 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
999578520 5:153007973-153007995 TTCAATAAAAATGAGAAGGGAGG + Intergenic
999609012 5:153349513-153349535 TTGAAAAAGCATGATCAAGGAGG + Intergenic
999700594 5:154224337-154224359 TAGAATAAGAATGATGAATGGGG - Intronic
999725277 5:154431591-154431613 ATGATTAAGAATGATGATGGGGG - Intergenic
999834766 5:155357506-155357528 TTGAATAGGAATGGTGAGAGTGG - Intergenic
999867410 5:155715976-155715998 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1000273909 5:159715533-159715555 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1000384522 5:160661751-160661773 TTGAATAAGAGTGGTGAGAGAGG - Intronic
1000501689 5:162059478-162059500 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1000507433 5:162138689-162138711 TTGAATAAGAGTGACGAGAGAGG + Intronic
1000509974 5:162168710-162168732 CTGAATAAGAGTGATGAGAGAGG - Intergenic
1000566103 5:162849381-162849403 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1000698330 5:164417471-164417493 TTGAATAAGAGTGGTTTGAGGGG + Intergenic
1001343882 5:170872547-170872569 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1001839337 5:174860988-174861010 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1002694918 5:181080635-181080657 TTGAATAAGAATGATAGTAGGGG - Intergenic
1202775759 5_GL000208v1_random:69249-69271 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1003239449 6:4330777-4330799 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1003937098 6:10986386-10986408 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1004090798 6:12498736-12498758 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1004653979 6:17640608-17640630 TTGAAAAAGAATGATTTCTGTGG - Intronic
1005171434 6:22989833-22989855 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1005523075 6:26617466-26617488 TTGAATAAGAGTGATGATAGTGG - Intergenic
1005698426 6:28374033-28374055 TTGAATAAGAGTGGTGAGAGTGG + Intergenic
1005745151 6:28830149-28830171 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1005789068 6:29277538-29277560 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1005791860 6:29311148-29311170 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1005846478 6:29783846-29783868 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1006217374 6:32455965-32455987 TTGAATAAGAATGGTGAGGGAGG - Intergenic
1006237598 6:32648735-32648757 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1006278448 6:33026227-33026249 TTGAATAGAAATGGTTAGAGTGG + Intergenic
1006962904 6:37951730-37951752 TTGAATAAGAGTGCTGAGAGTGG + Intronic
1007033363 6:38649698-38649720 ATGCATAAGAATGACTTGGGGGG + Intergenic
1007872712 6:45059540-45059562 TTGAATAGGAGTGATTAGAGAGG - Intronic
1008052285 6:46912555-46912577 TTAGGTAAGATTGATTAGGGAGG + Intronic
1008113450 6:47519196-47519218 TTGAACAAAAATGCTTGGGGAGG + Intronic
1008116651 6:47558360-47558382 TTGAATAGGAGTGATGAGAGAGG + Intronic
1008407246 6:51132409-51132431 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1008834252 6:55807107-55807129 TTGAATAGGAATGGTGAGAGGGG + Intronic
1009188705 6:60603919-60603941 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1009213004 6:60885620-60885642 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1009220894 6:60982983-60983005 TTGAATAAGAGTGTTGAGAGAGG + Intergenic
1009226244 6:61022740-61022762 TTGAATAGGAGTGATAAGAGAGG - Intergenic
1009264479 6:61535867-61535889 TTGAATAGGAGTGGTTAGGGAGG - Intergenic
1009361268 6:62817699-62817721 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1009457578 6:63875009-63875031 TTGAATAGGAGTGATGAGAGAGG + Intronic
1009503980 6:64451962-64451984 TTGAATAAGAGTGGTGAGAGAGG - Intronic
1009510503 6:64545474-64545496 TTGAATAGGAGTGGTTAGAGAGG - Intronic
1009511096 6:64550564-64550586 TTGAATAAGAGTGGTGAGAGAGG - Intronic
1009601547 6:65807648-65807670 TTGAGTAAGAATAAATAAGGAGG + Intergenic
1009755990 6:67940870-67940892 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1009871246 6:69454374-69454396 TTGAATATGAATGTTGAGAGAGG + Intergenic
1009947780 6:70359834-70359856 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1009998962 6:70928480-70928502 TGTAATAAGAATGATAAAGGGGG + Intronic
1010004238 6:70978253-70978275 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1010062351 6:71637726-71637748 TTGAATAAGAGTGATGAGAATGG - Intergenic
1010310098 6:74375080-74375102 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1010446582 6:75955637-75955659 TTGAATAGGAATGGTGAGAGAGG + Intronic
1010466979 6:76179193-76179215 TTGAATAGGAATGGTGAGAGTGG - Intergenic
1010491900 6:76486803-76486825 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1010582380 6:77615530-77615552 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1010604788 6:77874643-77874665 TTGAATAGGAATGGTGAGAGAGG + Intronic
1010670459 6:78680404-78680426 TTGAATAGGAGTGATGAGGGAGG - Intergenic
1010812076 6:80312463-80312485 TTGAATCAGAGTGATGAGAGAGG + Intronic
1010817808 6:80379550-80379572 TTGAATAAGAGTGATGAGAGTGG - Intergenic
1010871519 6:81047945-81047967 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1011063614 6:83299638-83299660 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1011086164 6:83543447-83543469 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1011234961 6:85206101-85206123 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1011244159 6:85304250-85304272 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1011289275 6:85759346-85759368 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1011339853 6:86302089-86302111 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1011365167 6:86573664-86573686 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1011377284 6:86703127-86703149 TTGAATAAGAATGAAGAGAGAGG + Intergenic
1011578600 6:88831543-88831565 TTGAATAGGAATGGTAAGAGAGG - Intronic
1011766634 6:90627203-90627225 TTGAATAGGAGTGGTTAGAGAGG - Intergenic
1011815759 6:91188256-91188278 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1011922694 6:92600691-92600713 TTGAATAAGAGTGGTAAGAGAGG - Intergenic
1012058913 6:94452435-94452457 TTGAATAAAAGTGATGAGGGTGG - Intergenic
1012063434 6:94515666-94515688 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1012204215 6:96440705-96440727 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1012238656 6:96847523-96847545 TTGAATAGGAATGGTGAGAGTGG - Intergenic
1012312060 6:97737697-97737719 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1012339441 6:98101587-98101609 TTGAATAGGAATGGTCAGAGAGG + Intergenic
1012448104 6:99327407-99327429 TTGAACAAGAGTGATTTTGGTGG - Intronic
1012498289 6:99859297-99859319 TTGAATAAGAGTGTTGAGAGAGG - Intergenic
1012584902 6:100910158-100910180 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1012613627 6:101248013-101248035 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1012640204 6:101600964-101600986 TTGAATAGGAGTGATGAGAGTGG + Intronic
1012674574 6:102099423-102099445 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1012688677 6:102286373-102286395 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1012821434 6:104089525-104089547 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1012834256 6:104245306-104245328 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1012904449 6:105048056-105048078 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1012941361 6:105419100-105419122 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1012980580 6:105826374-105826396 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1012988503 6:105900194-105900216 TTGAAAAAGCATGATGGGGGAGG + Intergenic
1013669622 6:112385737-112385759 TTGAATAAGACTGGTGAGAGAGG - Intergenic
1013708610 6:112870907-112870929 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1013741695 6:113294917-113294939 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1013860519 6:114630039-114630061 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1013952203 6:115796695-115796717 TTGATTAAGAATGATTATCCAGG - Intergenic
1014176659 6:118338583-118338605 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1014185019 6:118425133-118425155 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1014244008 6:119048333-119048355 TTGAATAAGAGTGGTGAGAGAGG - Intronic
1014503943 6:122229370-122229392 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1014628200 6:123755855-123755877 TTGAATAACAGTGATGAGAGTGG + Intergenic
1014714069 6:124843158-124843180 TTGAATAAGAAAGATAAGAAAGG - Intergenic
1014949129 6:127534810-127534832 TTGAATAAGAGTGTTGTGGGTGG + Intronic
1014975247 6:127872742-127872764 TTGCATAAGAGTGGTTAGAGTGG - Intronic
1015047810 6:128798040-128798062 TTAAATAAGAATGGTGAGAGTGG - Intergenic
1015157268 6:130110730-130110752 TTGAATAGGAGTGATGAGAGAGG + Intronic
1015162695 6:130170979-130171001 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1015291527 6:131542992-131543014 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1015362961 6:132361684-132361706 TAGAATCAGAATCTTTAGGGAGG - Intronic
1015722132 6:136253573-136253595 TTGAAAATGAATAATTAGGCCGG + Intergenic
1015802450 6:137074246-137074268 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1015853182 6:137595403-137595425 TTGAATAGGAGTGGTTAGAGTGG - Intergenic
1015906777 6:138125390-138125412 TTGAATAGGAGTGGTAAGGGAGG - Intergenic
1015931718 6:138367163-138367185 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1016168093 6:140973165-140973187 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1016638280 6:146320002-146320024 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1016656272 6:146521824-146521846 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1016855817 6:148669821-148669843 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1016900978 6:149101865-149101887 TTGAATAAGAATTATGAAAGTGG - Intergenic
1017148168 6:151253520-151253542 TTGAATAAGACTGTTTTGGCCGG - Intronic
1017408499 6:154145093-154145115 TTGAATAAGAGTAGTGAGGGTGG - Intronic
1018125058 6:160674435-160674457 TTGAATAGGACTGATGAGAGAGG - Intergenic
1018607098 6:165609461-165609483 TTGAATAGGAATGGTGAGAGAGG - Intronic
1018701085 6:166427405-166427427 TTGAATAGGAGTGATGAGAGAGG - Intronic
1019071511 6:169349913-169349935 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1019979185 7:4608603-4608625 TTAAATGAGAATGATTAGGCTGG - Intergenic
1020351460 7:7223803-7223825 TTGAGTAAGAGTGATGAGAGTGG + Intronic
1020366856 7:7390029-7390051 TTGAATAGGAATGGTGAGAGAGG + Intronic
1020584665 7:10051419-10051441 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1020688396 7:11324549-11324571 TTGAAAAAGAATAAATTGGGAGG + Intergenic
1020753034 7:12166921-12166943 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1020885382 7:13813662-13813684 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1021024960 7:15654450-15654472 TTGAATAAGAGTGGTGAGGGAGG + Intronic
1021385395 7:20023665-20023687 TTGAATATGAATGGTAAGAGAGG + Intergenic
1021429169 7:20539918-20539940 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1022079381 7:27004483-27004505 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022867859 7:34441143-34441165 TTAAATAAGAAAAATAAGGGGGG + Intergenic
1023146591 7:37157269-37157291 TTGAATAGGAATGGTGAGAGAGG - Intronic
1023201699 7:37705029-37705051 TTTAATAAGTATTATTAGAGTGG - Intronic
1023290506 7:38663952-38663974 TTGAATAAGAGTGGTGAGAGTGG - Intergenic
1024452790 7:49567160-49567182 TTGAATAAGAATGGTAAAAGAGG - Intergenic
1024756352 7:52537696-52537718 TTGAATAAGGAAGATGTGGGTGG - Intergenic
1024990149 7:55227825-55227847 TTGAATAGGAATGGTGAGAGAGG + Intronic
1025017876 7:55454903-55454925 TTGAATAGGAGTGATGAGAGAGG - Intronic
1025821844 7:64969516-64969538 TTGAATAGGAATATTTAGAGTGG + Intergenic
1025869592 7:65418839-65418861 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1026080483 7:67214537-67214559 TTGAATAGGAATGGTGAGAGGGG + Intronic
1026434109 7:70379201-70379223 TTGAAAAACTATTATTAGGGCGG + Intronic
1026696606 7:72599491-72599513 TTGAATAGGAATGGTGAGAGGGG - Intronic
1026989291 7:74574296-74574318 TTAAATAAGAATAATGAGGCCGG - Intronic
1027450018 7:78320726-78320748 TTGAATAAGAGTGGTGAGAGAGG - Intronic
1027496313 7:78891832-78891854 TTGAATAAGAGTGGTGAGAGAGG - Intronic
1027498962 7:78924232-78924254 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1027511559 7:79088547-79088569 TTGAATAGGAGTGATGAGAGAGG + Intronic
1027587145 7:80072507-80072529 TTGAATAAAAGTGATGAAGGTGG - Intergenic
1027638896 7:80709422-80709444 TTCAATCAAAATGATTAAGGTGG - Intergenic
1027949529 7:84796770-84796792 TTGAATAAGGATGGTGAGAGTGG + Intergenic
1027983339 7:85253821-85253843 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1028009032 7:85616682-85616704 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1028055135 7:86231610-86231632 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1028300647 7:89195292-89195314 TTGAATAGGAATGGTGAGAGAGG - Intronic
1028304932 7:89251045-89251067 TTGAATAAGAGTGGTGAGAGTGG - Intronic
1028325880 7:89524176-89524198 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1028560707 7:92172296-92172318 TTGAATAAGAGTGGTGAGAGTGG - Intronic
1028564628 7:92215927-92215949 TTGAATAAAAATGATTTTTGCGG + Intronic
1028691697 7:93660075-93660097 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1028699798 7:93764121-93764143 TTGAATAAGAATGGTGAGACTGG - Intronic
1028733997 7:94186085-94186107 TTGAATAGGAATGGTGAGGGAGG + Intergenic
1028767268 7:94573766-94573788 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1028771909 7:94635315-94635337 TTGGATAAGAATGATTAAGAAGG + Intronic
1028787930 7:94817873-94817895 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1029319475 7:99745471-99745493 TTGAATAAGAGTCATGAGTGAGG - Intergenic
1029330160 7:99846614-99846636 TTGAATAAGAATGGTGAGAGTGG + Intronic
1029780671 7:102728886-102728908 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1029807849 7:103015296-103015318 TTGAATAGGAGTGATGAGAGAGG - Intronic
1029919386 7:104246450-104246472 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1030134085 7:106229698-106229720 TTGAATAAAAGTGATGAGAGAGG + Intergenic
1030371438 7:108703961-108703983 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1030439982 7:109577112-109577134 TTGAATAAGAATTAGTTGGCTGG + Intergenic
1030526130 7:110657165-110657187 TTGAATATGAGTGGTTAGAGAGG + Intergenic
1030690268 7:112525471-112525493 GTGAATAAAAAAGATCAGGGTGG - Intergenic
1030721189 7:112872571-112872593 TTGAATAGGAGTGATGAGAGTGG - Intronic
1030725395 7:112920553-112920575 TTGAATAAGAGTGGTGAGAGAGG - Intronic
1030997405 7:116375341-116375363 TTGAATAGGAATGGTGAGAGAGG - Intronic
1031209491 7:118804234-118804256 TTGGATAAGAATGATAAGAGTGG + Intergenic
1031298018 7:120028531-120028553 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1031527425 7:122838382-122838404 TTGAATAGGAATGGTGAGAGAGG - Intronic
1032178249 7:129651119-129651141 CTGAATAAAAATGGTTAGAGAGG + Intronic
1032249719 7:130244976-130244998 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1032258147 7:130313234-130313256 TTGAAAAAGGTTGATTAGGCAGG + Intronic
1032910901 7:136428612-136428634 TTGATTAAAAATGATTATGTGGG - Intergenic
1032966726 7:137106272-137106294 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1033078825 7:138275220-138275242 TTGAATAAGAGTGATGAGAGTGG - Intergenic
1033572892 7:142650746-142650768 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1033612395 7:142976415-142976437 TTTAATAAGAGTGATTGGAGTGG - Intergenic
1033612648 7:142980281-142980303 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1033819115 7:145112087-145112109 TTAAATAAGAATGGTGAGAGAGG + Intergenic
1033888406 7:145977212-145977234 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1034150950 7:148914956-148914978 TTAAATAAAAATGATCAGGGAGG - Intergenic
1034388468 7:150762057-150762079 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1035348046 7:158220273-158220295 TTGAATAGGAGTGATGAGAGTGG - Intronic
1035599135 8:885659-885681 TTGAATAAGAGTGATGAGAGAGG + Intergenic
1035949533 8:4004998-4005020 TAGAATAAGAGTCACTAGGGAGG - Intronic
1036036655 8:5027688-5027710 TTATATAAAAAGGATTAGGGAGG + Intergenic
1036057555 8:5274600-5274622 TGGAACAAAAATGATGAGGGGGG + Intergenic
1036144555 8:6242754-6242776 TTGAAAAAGAATGTTAAGGTGGG + Intergenic
1036247793 8:7134452-7134474 TTGAATAAGAATGGTGAAAGTGG + Intergenic
1036462611 8:8967003-8967025 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1037032898 8:14130894-14130916 TTGCATAAAAAATATTAGGGTGG + Intronic
1037181082 8:16006342-16006364 TTGAATAGGAATGGTAAGAGAGG + Intergenic
1037560256 8:20067228-20067250 TTGAAGAAGACTGGTGAGGGTGG + Intergenic
1038221374 8:25611409-25611431 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1038870260 8:31486136-31486158 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1038990626 8:32863712-32863734 TTGAATAAGAGTGGTTAGCATGG - Intergenic
1039036404 8:33364375-33364397 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1039170753 8:34742141-34742163 TTGAATAGGAGTGGTTAGAGAGG - Intergenic
1039438002 8:37573907-37573929 TTGAATAAGAATAACTAGCATGG + Intergenic
1039636706 8:39175221-39175243 TTGAATAGGAATGGTGAGAGAGG + Intronic
1039654567 8:39387650-39387672 TTGAATAAGAGTGTTGAGAGAGG + Intergenic
1039718828 8:40140258-40140280 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1039754411 8:40508105-40508127 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1039984031 8:42433106-42433128 ATAAATAAGAATGATTACGATGG - Intronic
1040078315 8:43262617-43262639 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1040483315 8:47846608-47846630 TTGAATAGGAGTGATGAGAGTGG - Intronic
1040686318 8:49877155-49877177 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1040693763 8:49971468-49971490 TTGAATAGGAGTGGTGAGGGAGG - Intronic
1040754827 8:50760376-50760398 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1041101044 8:54396689-54396711 TTGGAGGAGAAAGATTAGGGTGG + Intergenic
1041127591 8:54660217-54660239 TTGAATAGAAATGATGAGAGTGG + Intergenic
1041308599 8:56490239-56490261 TTGAATAAGAGTGCTAAGAGTGG - Intergenic
1041518482 8:58728751-58728773 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1041575092 8:59384932-59384954 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1041607954 8:59806784-59806806 TTGAATAAGGGTGATAAGGATGG - Intergenic
1041655207 8:60342506-60342528 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1041852778 8:62411508-62411530 TTGAATAAGAGTGGTGAGAGTGG - Intronic
1041859328 8:62494061-62494083 TTGAATAGGAGTGATTAGAAAGG + Intronic
1042110065 8:65371814-65371836 TTGAATAGGAATGATGAGAGTGG - Intergenic
1042111310 8:65384048-65384070 TTGAATAGGAGTGGTTAGAGAGG - Intergenic
1042115830 8:65430441-65430463 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1042116485 8:65437398-65437420 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1042332161 8:67591924-67591946 TTGAATAGGAGTGATGAGAGAGG + Intronic
1042465652 8:69127731-69127753 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1042633821 8:70850886-70850908 TTGAATAAGAGTGGTCAGAGAGG - Intergenic
1042644924 8:70976262-70976284 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1042959668 8:74290102-74290124 TTGAATAGGAGTGATGAGAGAGG - Intronic
1043244067 8:77975779-77975801 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1043279778 8:78448944-78448966 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1043327129 8:79066179-79066201 TTGAATAGGAATGTTGAGAGTGG - Intergenic
1043339667 8:79222370-79222392 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1043412022 8:80007375-80007397 TTGAATAAGAGTGGTGAGAGAGG - Intronic
1043617549 8:82145408-82145430 TTGAATAGGAGTGGTTAGAGAGG + Intergenic
1043697025 8:83232535-83232557 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1044038229 8:87333412-87333434 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1044053577 8:87540282-87540304 TTGAATAGGAATGGTGAGAGAGG + Intronic
1044129270 8:88500201-88500223 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1044165285 8:88975108-88975130 TTGAATAGGAATGGTAAGAGAGG - Intergenic
1044410161 8:91873478-91873500 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1044412114 8:91895303-91895325 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1044455826 8:92392137-92392159 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1044596663 8:93965854-93965876 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1045045479 8:98271725-98271747 TTGAATAGGAGTGGTTAGAGTGG + Intronic
1045200053 8:99971330-99971352 TTGAATAGGAATGGTGAGAGAGG - Intronic
1045212480 8:100112695-100112717 TTGAATAGGAATGGTGAGAGAGG - Intronic
1045647379 8:104312672-104312694 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1045651378 8:104344590-104344612 TTGATTGAGAAGGTTTAGGGTGG - Intronic
1045728297 8:105201977-105201999 TTGAATAAGAGTGGTGAGAGAGG - Intronic
1045817041 8:106289127-106289149 TTGAATAGGAGTGGTTAGAGTGG - Intronic
1046025423 8:108717621-108717643 TTTAAACAGAATGATTAAGGTGG + Intronic
1046031839 8:108791587-108791609 TTTAATAAGAATGCTTACAGTGG + Intergenic
1046106839 8:109676240-109676262 TTGAATAGGAGTGATGACGGAGG - Intronic
1046127727 8:109931203-109931225 TTGAGTAAGAATGAGATGGGAGG + Intergenic
1046152477 8:110246157-110246179 TTGAATAGGAATGAGGAGAGTGG + Intergenic
1046172548 8:110530033-110530055 TTGAATAAGAGTGATGAGAGTGG + Intergenic
1046255349 8:111689859-111689881 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1046329374 8:112695685-112695707 TTGAATAGGAATGGTGAGAGAGG - Intronic
1046684606 8:117211131-117211153 TTGAATAAGAGTGATGAGAGAGG - Intergenic
1046706220 8:117455377-117455399 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1046828643 8:118719754-118719776 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1046866936 8:119161434-119161456 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1046874409 8:119237892-119237914 TTGAATAGGAATGGTGAGAGAGG - Intronic
1046954007 8:120044976-120044998 TTAAATAAGATTTATTAGGTAGG - Intronic
1047063356 8:121252426-121252448 TAGAATGTGAATGATTATGGTGG + Intergenic
1047156824 8:122328710-122328732 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1047165417 8:122432857-122432879 TTGAATCAGGGTGATGAGGGTGG - Intergenic
1047200862 8:122765575-122765597 TTGAATAAGAGTGGTGAGAGCGG - Intergenic
1047357849 8:124140303-124140325 TAAAATAGGAATAATTAGGGAGG - Intergenic
1047369182 8:124241606-124241628 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1047445108 8:124912655-124912677 TGGCATAATAAAGATTAGGGTGG + Intergenic
1047604485 8:126461364-126461386 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1047661764 8:127045087-127045109 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1047699940 8:127438998-127439020 TTGAATAGGAGTGGTTAGAGTGG - Intergenic
1047899093 8:129400221-129400243 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1048122355 8:131596072-131596094 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1048388918 8:133941732-133941754 TTGAATAGGAATGATCAGACAGG - Intergenic
1048614915 8:136063237-136063259 TTGAACAAGAGTGATGAGAGTGG - Intergenic
1049974245 9:846535-846557 TAGAATAAGATTGGCTAGGGAGG - Intronic
1050169812 9:2803578-2803600 TTGAATAAGAAGGAAGAAGGTGG - Intronic
1050403358 9:5280737-5280759 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1050505087 9:6339959-6339981 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1050590709 9:7157391-7157413 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1050661127 9:7884026-7884048 TTGAATAGGAGTGGTGAGGGAGG - Intronic
1050981070 9:12016967-12016989 TTTAAGAAGAATTTTTAGGGTGG - Intergenic
1051110607 9:13631260-13631282 TTGAATAAGAGTGATGAAAGAGG - Intergenic
1051300783 9:15648351-15648373 TTGAATAGGAATGGTGAGAGAGG - Intronic
1051549104 9:18309290-18309312 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1051674156 9:19542477-19542499 TTGAATAGGAGTGATGAGAGAGG + Intronic
1051704690 9:19864791-19864813 TTGAATAACAATGATGAAAGTGG - Intergenic
1051708658 9:19907430-19907452 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1051861593 9:21631197-21631219 TTGAATAGGAGTGATGAGTGTGG - Intergenic
1051908364 9:22123388-22123410 TTGAATAAGAATGTTAAGAGTGG + Intergenic
1051968464 9:22858807-22858829 TTGAATACGAGTGATGAGAGAGG - Intergenic
1052005613 9:23344711-23344733 TTGAATAGGAATGGTGAGAGTGG - Intergenic
1052094276 9:24365610-24365632 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1052114731 9:24636607-24636629 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1052115095 9:24640768-24640790 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1052134457 9:24892818-24892840 TTGAATAAGAGTGGTGAGAGGGG - Intergenic
1052158951 9:25231039-25231061 TTGAATAAGAGTGATGAGAGAGG + Intergenic
1052386906 9:27833461-27833483 TTGAATAGGAGTGATCAGAGAGG + Intergenic
1052546323 9:29885430-29885452 TTAAAAAAGAATTATTAGAGAGG - Intergenic
1052632362 9:31058105-31058127 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1052645264 9:31226545-31226567 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1052720901 9:32169930-32169952 TTGGCTAAGAATTATTATGGTGG - Intergenic
1053041213 9:34874233-34874255 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1053083254 9:35195071-35195093 TTGCATTAAAAAGATTAGGGTGG - Intronic
1053531176 9:38883119-38883141 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1053568400 9:39277878-39277900 TTGAATAGGAGTGATGAGAGAGG - Intronic
1053583280 9:39429398-39429420 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1053685422 9:40516264-40516286 TTGAATAAGAGTGGTAAGAGAGG - Intergenic
1053688854 9:40569829-40569851 TTGAATAAAAGTGATGAGGCTGG - Intergenic
1053935374 9:43144559-43144581 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1054104860 9:60988141-60988163 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1054203398 9:62107551-62107573 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1054275183 9:63061245-63061267 TTGAATAAAAGTGATGAGGCTGG + Intergenic
1054278313 9:63108698-63108720 TTGAATAAGAGTGGTAAGAGAGG + Intergenic
1054298503 9:63351722-63351744 TTGAATAAGAGTGGTAAGAGAGG - Intergenic
1054300094 9:63370746-63370768 TTGAATAAAAGTGATGAGGCTGG - Intergenic
1054396526 9:64656235-64656257 TTGAATAAGAGTGGTAAGAGAGG - Intergenic
1054399648 9:64703695-64703717 TTGAATAAAAGTGATGAGGCTGG - Intergenic
1054431168 9:65161438-65161460 TTGAATAAGAGTGGTAAGAGAGG - Intergenic
1054433231 9:65187956-65187978 TTGAATAAAAGTGATGAGGCTGG - Intergenic
1054497152 9:65833713-65833735 TTGAATAAAAGTGATGAGGCTGG + Intergenic
1054499213 9:65860087-65860109 TTGAATAAGAGTGGTAAGAGAGG + Intergenic
1054634964 9:67480813-67480835 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1054884549 9:70181893-70181915 TTGAATAGGAATGGTGAGAGAGG + Intronic
1054890348 9:70244399-70244421 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1055061809 9:72076618-72076640 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1055131660 9:72782413-72782435 TTGAATAAGAATAGTGAGGGTGG - Intronic
1055155301 9:73055563-73055585 ATGAATAAGAATGATGAGACTGG - Intronic
1055210684 9:73787132-73787154 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1055234443 9:74103458-74103480 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1055622134 9:78137247-78137269 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1055743832 9:79420667-79420689 TTGAATAAGAGTGATAACAGTGG + Intergenic
1055843654 9:80535108-80535130 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1055853159 9:80656154-80656176 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1055853594 9:80660215-80660237 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1055873675 9:80916929-80916951 TTGAATAGGAGTGGTTAGAGAGG - Intergenic
1056001332 9:82220032-82220054 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1056015973 9:82388197-82388219 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1056181509 9:84087800-84087822 TTGAATAGAAGTGATGAGGGAGG + Intergenic
1056372167 9:85967509-85967531 ATGAATAAGAATGATTTGGCCGG + Intronic
1057778591 9:98031005-98031027 TTGAATAAGAGTGGTGAGAGTGG - Intergenic
1058184420 9:101837887-101837909 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1058187515 9:101872495-101872517 TTGAATAGGAATGGTGAGAGGGG - Intergenic
1058196991 9:101989360-101989382 TTGAATAAGAGTGATGAGAGAGG - Intergenic
1058250916 9:102695013-102695035 TTGAATACGAGTGATTAGAGAGG - Intergenic
1058403230 9:104641307-104641329 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1058405171 9:104664931-104664953 TTGAATAGGAATGGTGAGAGTGG - Intergenic
1059022843 9:110595574-110595596 TGGAATAAGAATGGTGAGAGAGG + Intergenic
1059063407 9:111057579-111057601 TTGAATAAGATAGATTAGTTGGG - Intergenic
1059077005 9:111204057-111204079 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1059216075 9:112563768-112563790 TTGAATAAGAGTGATACAGGTGG + Intronic
1059380901 9:113923329-113923351 TTGAATAGGAATTATGAGAGAGG + Intronic
1059746903 9:117211130-117211152 TTTGACAAGAATGATTAGAGTGG - Intronic
1059916469 9:119108219-119108241 TTTAATAAGAATGGTGAGGTGGG - Intergenic
1060450042 9:123729215-123729237 TTGAATAGGAGTGGTGAGGGGGG - Intronic
1061554027 9:131355430-131355452 TTGAAAAAGAATAATAAAGGTGG - Intergenic
1061749353 9:132765792-132765814 TTGAATAAGAGCGATGAGAGTGG - Intronic
1203438116 Un_GL000195v1:162172-162194 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1203532403 Un_GL000213v1:158691-158713 TTGAATAAGAATGGTGAGAAAGG + Intergenic
1203459683 Un_GL000220v1:22599-22621 TTGAATAGGAGTGCTGAGGGAGG + Intergenic
1203380431 Un_KI270435v1:32322-32344 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1203345281 Un_KI270442v1:29781-29803 TTGAATAGGATTGAATGGGGTGG + Intergenic
1203554830 Un_KI270743v1:197632-197654 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1186138407 X:6544971-6544993 TTGAATAAGAGTGATGAGAGAGG + Intergenic
1186593601 X:10957024-10957046 TTGAATAGGAATGATGAGAGTGG - Intergenic
1186740631 X:12514255-12514277 TTGAATAGGAATGGTGAGAGAGG + Intronic
1187105011 X:16232727-16232749 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1187117173 X:16364159-16364181 TTGAATAGGAATGATGAGAGAGG - Intergenic
1187141562 X:16599162-16599184 TTGAATAGGAGTGATGAGAGAGG - Intronic
1187211054 X:17232057-17232079 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1187222691 X:17344520-17344542 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1187605563 X:20878692-20878714 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1187749889 X:22450776-22450798 TTGAATATGAATGGTGAGAGTGG - Intergenic
1187769630 X:22680915-22680937 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1187945482 X:24422593-24422615 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1188014451 X:25092657-25092679 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1188035557 X:25313887-25313909 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1188119737 X:26289476-26289498 TTGAATAGGAGTGATCAGAGTGG + Intergenic
1188140230 X:26541116-26541138 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1188229641 X:27645519-27645541 TTGAATAAGAGTGGTGAGAGAGG - Intronic
1188664483 X:32802513-32802535 TTGAATAGGAGTGATGAGAGAGG + Intronic
1188669943 X:32869918-32869940 TTGAATAGGAATGGTAAGAGAGG - Intronic
1188724730 X:33568610-33568632 TTGAATAAAAATGATGAAAGTGG + Intergenic
1188755601 X:33957694-33957716 TAGAATAAAAATAATTAGGTTGG - Intergenic
1188771093 X:34155563-34155585 TTGAATAAGAGTGATGAGAGAGG + Intergenic
1188796837 X:34477546-34477568 TTGAATAAGAATGATGAGAAAGG + Intergenic
1188900740 X:35730135-35730157 TCGAATAAGAATGGTGAGAGAGG + Intergenic
1188915221 X:35902687-35902709 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1188969230 X:36592904-36592926 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1188983284 X:36747732-36747754 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1189209564 X:39273143-39273165 TTGAATAAGAGTGGTGAGGGAGG + Intergenic
1189581302 X:42409737-42409759 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1189584009 X:42438791-42438813 TTGAATAGGAATGGTGAGAGTGG - Intergenic
1189598336 X:42593751-42593773 TTGAATAGGAGTGATAAGAGAGG - Intergenic
1189614609 X:42770343-42770365 TTGAAAAAGACTAATTAGGCAGG - Intergenic
1189832142 X:44985447-44985469 TTGAATAGGAGTGATGAGAGAGG + Intronic
1189834007 X:45002868-45002890 TTGGAGAAGAATGAAAAGGGGGG - Intronic
1189866220 X:45330291-45330313 TTGAATAAGAGTGGTGAGAGTGG + Intergenic
1190149622 X:47933601-47933623 TTGAATAAGAATGATCAAAGAGG + Intronic
1190369672 X:49728393-49728415 TTGAAGAAGAATGATGAGAGTGG + Intergenic
1190429040 X:50360647-50360669 TTGAATAAGAGTTATTAGGGAGG - Intergenic
1190467298 X:50738282-50738304 TTGAATAGGAGTGATGAGAGAGG - Intronic
1190584860 X:51929379-51929401 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1190585872 X:51941338-51941360 TTGAATAAGAGTGATGAGAGAGG - Intergenic
1190593374 X:52027663-52027685 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1190606352 X:52147366-52147388 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1190836464 X:54105512-54105534 TTGAATAGGAATGGTGAGAGAGG - Intronic
1190922349 X:54866342-54866364 TTGAATAGGAGTGGTGAGGGTGG + Intergenic
1190954437 X:55178624-55178646 TTGAATTAGAAGGCTTAAGGCGG + Intronic
1190968157 X:55322899-55322921 TTGGATAAGAGTGATAAAGGTGG + Intergenic
1190970869 X:55346180-55346202 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1190977477 X:55420322-55420344 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1191019865 X:55847806-55847828 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1191020570 X:55855920-55855942 TTGAATAGGAGTGATGAGGGAGG + Intergenic
1191023443 X:55887734-55887756 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1191042860 X:56103749-56103771 TTGAATAGGAGTGATGAGAGTGG + Intergenic
1191132932 X:57034086-57034108 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1191156094 X:57274858-57274880 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1191163638 X:57363602-57363624 TTGAATAGGAGTGATGAGGGTGG + Intronic
1191170370 X:57440639-57440661 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1191173210 X:57471199-57471221 TTGAATAGGAATGGTGAGAGAGG - Intronic
1191179884 X:57550499-57550521 TTGAATAAGAATGGTGAAAGTGG - Intergenic
1191196337 X:57727515-57727537 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1191203240 X:57807070-57807092 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1191209202 X:57867247-57867269 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1191223808 X:58018269-58018291 CTGAATAAGAACCATTAGTGGGG - Intergenic
1191565365 X:62521067-62521089 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1191595509 X:62939267-62939289 TTGAATAAGAGTGTTGAGAGAGG + Intergenic
1191598951 X:62981651-62981673 TTGAATAAGAGTGGTAAGAGTGG + Intergenic
1191606519 X:63068444-63068466 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1191635448 X:63371149-63371171 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1191649688 X:63523219-63523241 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1191657130 X:63610604-63610626 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1191685098 X:63881514-63881536 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1191685817 X:63889281-63889303 TTGAATAAGAGTGGTGAGAGTGG - Intergenic
1191702622 X:64059541-64059563 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1191703458 X:64067567-64067589 TTGAATAGGAGTGATAAGAGAGG + Intergenic
1191704573 X:64080899-64080921 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1191705460 X:64089714-64089736 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1191707617 X:64110776-64110798 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1191709440 X:64133917-64133939 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1191785370 X:64911702-64911724 TTGAATAAGATTGGTGAGAGAGG - Intergenic
1191804368 X:65118600-65118622 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1191818875 X:65280498-65280520 TTGAATAAAAATGGTGAGAGTGG - Intergenic
1191827908 X:65385682-65385704 TTGAATAGGAATGGTGAGAGAGG + Intronic
1191950585 X:66587314-66587336 TTGAATAGGAATGTTGAGAGAGG + Intergenic
1191959310 X:66682500-66682522 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1191964504 X:66742413-66742435 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1191992885 X:67058254-67058276 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1192001132 X:67152614-67152636 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1192008024 X:67238184-67238206 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1192011852 X:67281962-67281984 TTGAATAAGAGTGATGACAGAGG - Intergenic
1192048945 X:67705683-67705705 TTGAATAGGAATGGTGAGAGAGG + Intronic
1192061679 X:67834015-67834037 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1192635601 X:72813588-72813610 TTGAATAGGAGTGATGAGAGAGG + Intronic
1192646113 X:72907215-72907237 TTGAATAGGAGTGATGAGAGAGG - Intronic
1192700839 X:73470011-73470033 TTGAATAAGAGTGGTGAGAGTGG + Intergenic
1192707735 X:73544555-73544577 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1192816207 X:74595176-74595198 TTGAATCAGAATGCTTTAGGTGG - Intronic
1192828570 X:74726152-74726174 TTGAATAGGAGTGATAAGAGAGG + Intergenic
1192832010 X:74760425-74760447 TTGAATAGGAACGGTGAGGGAGG + Intronic
1192880771 X:75281302-75281324 TTGAAGAGGAATGGTGAGGGTGG + Intronic
1192939298 X:75896109-75896131 TTGAATAGGAGTGGTTAGAGAGG + Intergenic
1192942878 X:75931534-75931556 TTGAATAGGAGTGGTAAGGGAGG + Intergenic
1192953362 X:76041316-76041338 TTGAATAGGAATGGTAAGAGTGG + Intergenic
1192953948 X:76048833-76048855 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1192966158 X:76179329-76179351 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1192969172 X:76213272-76213294 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1192976517 X:76291959-76291981 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1192982504 X:76361085-76361107 TTGAATAAGAGTGGTAAGAGAGG + Intergenic
1192984636 X:76383784-76383806 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1192993292 X:76485579-76485601 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1193002302 X:76576488-76576510 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1193035580 X:76947206-76947228 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1193091521 X:77498666-77498688 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1193095312 X:77541921-77541943 TTGAATAGGAGTGATGAGAGAGG - Intronic
1193171738 X:78345236-78345258 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1193202899 X:78713375-78713397 TGTAATAAGCATGATTAGAGAGG + Intergenic
1193216056 X:78865922-78865944 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1193227402 X:78999790-78999812 TTGAATAAAAATGGTGAGAGAGG - Intergenic
1193249873 X:79278311-79278333 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1193261171 X:79407916-79407938 TTGAATAGGACTGATGAGAGAGG - Intergenic
1193309360 X:79987274-79987296 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1193315703 X:80062583-80062605 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1193384977 X:80858993-80859015 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1193389583 X:80910802-80910824 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1193436602 X:81481387-81481409 TTTAATAAGAGTGGTGAGGGAGG - Intergenic
1193444382 X:81581967-81581989 GTGAATAGGAGTGATGAGGGTGG - Intergenic
1193583247 X:83290384-83290406 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1193594234 X:83426193-83426215 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1193685818 X:84575640-84575662 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1193714117 X:84917240-84917262 TTGAATAGTAATGATGAGAGTGG - Intergenic
1193719108 X:84967413-84967435 TTGAATAAGAGTGATGAGAGAGG + Intergenic
1193766352 X:85533168-85533190 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1193773528 X:85616657-85616679 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1193835283 X:86335786-86335808 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1193893843 X:87085902-87085924 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1193922366 X:87445155-87445177 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1194003507 X:88461487-88461509 TTGAATAAAAATGCTGAGAGTGG - Intergenic
1194055187 X:89123286-89123308 TTGAATAAGAATGGTGAAAGAGG + Intergenic
1194074431 X:89371015-89371037 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1194158900 X:90426534-90426556 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1194211075 X:91070032-91070054 TTGAATAAGAGTGGTGAGAGTGG - Intergenic
1194230925 X:91322673-91322695 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1194287833 X:92032518-92032540 TTGAATAACAATGGTTAAAGTGG + Intronic
1194365072 X:93004811-93004833 TTGAATAGTAATGATGAGAGAGG + Intergenic
1194404091 X:93472654-93472676 TTGAATAGGAGTGGTTAGAGGGG - Intergenic
1194504198 X:94712624-94712646 TTGAATAGGAGTGATGAGAGTGG - Intergenic
1194537962 X:95130825-95130847 TTGAATATGAGTGATAAGAGAGG - Intergenic
1194625153 X:96218624-96218646 TTGAATAGGAATGGTTAGAGAGG - Intergenic
1194658483 X:96601725-96601747 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1194733948 X:97489476-97489498 TTGAATATAAATGGTGAGGGTGG + Intronic
1194958694 X:100210836-100210858 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1195103349 X:101577884-101577906 TTAAATAAGAATGGTGAGAGTGG + Intergenic
1195103690 X:101582069-101582091 TTGAATAGGAGTGGTTAGAGAGG + Intergenic
1195148182 X:102039301-102039323 TTGAATAAGAGTGGTGAGAGTGG - Intergenic
1195149523 X:102051922-102051944 TTGAAAAAGAATGGTGAGAGAGG + Intergenic
1195270500 X:103224413-103224435 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1195414598 X:104606423-104606445 TTGAATAAGAGTGGTGAGAGAGG - Intronic
1195500324 X:105590407-105590429 TTGAATATGAGTGCTTAGAGAGG + Intronic
1195553204 X:106191578-106191600 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1195740115 X:108056373-108056395 TTGAATAAGAGAGATGAGAGTGG - Intronic
1195810069 X:108819111-108819133 TTGAATAATAGTGGTTAGAGAGG + Intergenic
1195930968 X:110075495-110075517 TTGAATAGGAATGGTGAGAGCGG + Intronic
1196052122 X:111316530-111316552 TTGAATAAGAGTGGTGAGAGAGG - Intronic
1196115511 X:111995002-111995024 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1196335057 X:114522823-114522845 TTGAATAGGAGTGATGAGAGAGG - Intergenic
1196550016 X:117013246-117013268 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1196557288 X:117103235-117103257 TTGAATAAAAATGGTGAGAGTGG - Intergenic
1196608134 X:117679136-117679158 TTGAATAGGAATGGTGAGAGTGG - Intergenic
1196872710 X:120127849-120127871 TTGAATAACAAGGACGAGGGTGG + Intergenic
1196982160 X:121227009-121227031 TTGAATAAGAGTGATGAGAGAGG + Intergenic
1197099234 X:122632418-122632440 TTGAATAAGAATGGTGAGAGTGG + Intergenic
1197109843 X:122759133-122759155 TTGAATAAGAGTGGTGAGAGTGG + Intergenic
1197191471 X:123652385-123652407 TTGAATAGGAATGGTGAGAGAGG - Intronic
1197279183 X:124515302-124515324 TTGAATAGGACTGATGAGAGAGG - Intronic
1197368360 X:125595325-125595347 TTGAATAAGAGTGATGAAGGTGG - Intergenic
1197391011 X:125864532-125864554 TTGAATAAGAGTGGTGAGAGTGG - Intergenic
1197447089 X:126563714-126563736 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1197448338 X:126580209-126580231 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1197523050 X:127523598-127523620 TTGAATAGGAATGGTGAGGGAGG - Intergenic
1197571102 X:128151734-128151756 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1197672343 X:129292037-129292059 TTGAATAGGAATGATGAGAGAGG - Intergenic
1197989999 X:132307816-132307838 TTGAATAAGAATGGTGAGAGAGG + Intergenic
1198001881 X:132447788-132447810 TTGAATAGGAGTGATGAGAGAGG + Intronic
1198067223 X:133110455-133110477 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1198474126 X:136979163-136979185 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1198579028 X:138043051-138043073 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1198726634 X:139685107-139685129 TTGAATAGGAGTGATAAGAGTGG - Intronic
1198769657 X:140116248-140116270 TTGCATAAGACTGGTGAGGGAGG + Intergenic
1198872135 X:141187538-141187560 TTGAATAACAATGATGAAAGTGG + Intergenic
1198960707 X:142179777-142179799 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1199129093 X:144163268-144163290 TTGAATAAGAATGGTAAGAGAGG - Intergenic
1199131674 X:144196325-144196347 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1199284453 X:146040437-146040459 TTGAGTAGAAATGTTTAGGGTGG - Intergenic
1199437671 X:147830900-147830922 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1199544903 X:148997830-148997852 GTGAATATGATTGATTAGTGAGG - Exonic
1199702643 X:150394972-150394994 TTGAAAAGGAATGATGAGAGTGG + Intronic
1199751227 X:150820624-150820646 TTGAATAAGAGTGGTAAGAGTGG - Intronic
1199776803 X:151019151-151019173 TTGAATAAGGATGATTATCATGG + Intergenic
1200388114 X:155914399-155914421 TTGAATAGGAGTGGTGAGGGAGG + Intronic
1200471448 Y:3591095-3591117 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1200505215 Y:4003494-4003516 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1200571146 Y:4831178-4831200 TTGAATAGGAGTGGTAAGGGAGG - Intergenic
1200583406 Y:4977336-4977358 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1200605361 Y:5257077-5257099 TTGAATAACAATGGTTAAAGTGG + Intronic
1200673300 Y:6121071-6121093 TTGAATAGTAATGATGAGAGAGG + Intergenic
1200729827 Y:6722542-6722564 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1200823525 Y:7614490-7614512 TTGAATAAGAGTGGTGAGAGGGG + Intergenic
1200887985 Y:8290751-8290773 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1201070077 Y:10139801-10139823 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1201078967 Y:10215421-10215443 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1201186136 Y:11404736-11404758 TTGAATAGGAGTGATGAGAGAGG + Intergenic
1201262190 Y:12170349-12170371 TTAAATAGGAATGATGAGAGAGG + Intergenic
1201409472 Y:13684534-13684556 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1201497902 Y:14609249-14609271 TTGAATAAGAGTGGTGAGAGAGG + Intronic
1201595590 Y:15664810-15664832 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1201619731 Y:15943015-15943037 TTGAATAAGAGTTGTGAGGGAGG + Intergenic
1201647395 Y:16250576-16250598 TTGAACAGGAATGGTTAGAGAGG - Intergenic
1201655416 Y:16334725-16334747 TTGAACAGGAATGGTTAGAGAGG + Intergenic
1201783668 Y:17749885-17749907 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1201800341 Y:17948205-17948227 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1201801212 Y:17957751-17957773 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1201817885 Y:18156102-18156124 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1202084848 Y:21125563-21125585 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1202104843 Y:21352508-21352530 TTGAATACGAGTGGTTAGAGAGG + Intergenic
1202175011 Y:22090152-22090174 TTGAATAGGAATGGTGAGAGAGG - Intronic
1202216351 Y:22496231-22496253 TTGAATAGGAATGGTGAGAGAGG + Intronic
1202236532 Y:22716605-22716627 TTGAATAAGAGTGGTGAGAGGGG - Intergenic
1202306633 Y:23479563-23479585 TTGAATAAGAGTGGTGAGAGGGG + Intergenic
1202326835 Y:23699833-23699855 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1202357036 Y:24062737-24062759 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1202361156 Y:24111714-24111736 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1202374915 Y:24225972-24225994 TTGAATAAGAGTGGTGAGAGAGG - Intergenic
1202495865 Y:25444148-25444170 TTGAATAAGAGTGGTGAGAGAGG + Intergenic
1202509622 Y:25558404-25558426 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1202513741 Y:25607377-25607399 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1202543934 Y:25970219-25970241 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1202564174 Y:26191026-26191048 TTGAATAAGAGTGGTGAGAGGGG - Intergenic