ID: 915713043

View in Genome Browser
Species Human (GRCh38)
Location 1:157919613-157919635
Sequence GTGGGGAAGCAGAAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915713043_915713055 30 Left 915713043 1:157919613-157919635 CCCTCCTGCTTCTGCTTCCCCAC No data
Right 915713055 1:157919666-157919688 AAGACTTTACCTGGTAGCCTAGG No data
915713043_915713054 21 Left 915713043 1:157919613-157919635 CCCTCCTGCTTCTGCTTCCCCAC No data
Right 915713054 1:157919657-157919679 CAGCAGAGAAAGACTTTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915713043 Original CRISPR GTGGGGAAGCAGAAGCAGGA GGG (reversed) Intergenic
No off target data available for this crispr