ID: 915716565

View in Genome Browser
Species Human (GRCh38)
Location 1:157950148-157950170
Sequence GAGGGGAAACAGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915716550_915716565 11 Left 915716550 1:157950114-157950136 CCATCAAAAAAAGAAAGAGAAGG No data
Right 915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915716565 Original CRISPR GAGGGGAAACAGAGGGAGGG AGG Intergenic
No off target data available for this crispr