ID: 915718523

View in Genome Browser
Species Human (GRCh38)
Location 1:157966377-157966399
Sequence GACCTCAGCAGTAAATCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915718523_915718526 13 Left 915718523 1:157966377-157966399 CCTGCTGATTTACTGCTGAGGTC No data
Right 915718526 1:157966413-157966435 ACAAATTCTGCTAGCCAGCTGGG No data
915718523_915718525 12 Left 915718523 1:157966377-157966399 CCTGCTGATTTACTGCTGAGGTC No data
Right 915718525 1:157966412-157966434 TACAAATTCTGCTAGCCAGCTGG No data
915718523_915718527 26 Left 915718523 1:157966377-157966399 CCTGCTGATTTACTGCTGAGGTC No data
Right 915718527 1:157966426-157966448 GCCAGCTGGGCAGACACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915718523 Original CRISPR GACCTCAGCAGTAAATCAGC AGG (reversed) Intergenic
No off target data available for this crispr