ID: 915720663

View in Genome Browser
Species Human (GRCh38)
Location 1:157983039-157983061
Sequence CAGTGTGGACAGAGGGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915720663_915720671 9 Left 915720663 1:157983039-157983061 CCCGCTGCCCTCTGTCCACACTG No data
Right 915720671 1:157983071-157983093 AGCTTAAGAGATCCTGACTCAGG No data
915720663_915720672 10 Left 915720663 1:157983039-157983061 CCCGCTGCCCTCTGTCCACACTG No data
Right 915720672 1:157983072-157983094 GCTTAAGAGATCCTGACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915720663 Original CRISPR CAGTGTGGACAGAGGGCAGC GGG (reversed) Intergenic
No off target data available for this crispr