ID: 915720672

View in Genome Browser
Species Human (GRCh38)
Location 1:157983072-157983094
Sequence GCTTAAGAGATCCTGACTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915720664_915720672 9 Left 915720664 1:157983040-157983062 CCGCTGCCCTCTGTCCACACTGC No data
Right 915720672 1:157983072-157983094 GCTTAAGAGATCCTGACTCAGGG No data
915720660_915720672 26 Left 915720660 1:157983023-157983045 CCTTTGGCTTGCTTCCCCCGCTG No data
Right 915720672 1:157983072-157983094 GCTTAAGAGATCCTGACTCAGGG No data
915720662_915720672 11 Left 915720662 1:157983038-157983060 CCCCGCTGCCCTCTGTCCACACT No data
Right 915720672 1:157983072-157983094 GCTTAAGAGATCCTGACTCAGGG No data
915720666_915720672 2 Left 915720666 1:157983047-157983069 CCTCTGTCCACACTGCCCAACCT No data
Right 915720672 1:157983072-157983094 GCTTAAGAGATCCTGACTCAGGG No data
915720663_915720672 10 Left 915720663 1:157983039-157983061 CCCGCTGCCCTCTGTCCACACTG No data
Right 915720672 1:157983072-157983094 GCTTAAGAGATCCTGACTCAGGG No data
915720667_915720672 -5 Left 915720667 1:157983054-157983076 CCACACTGCCCAACCTCAGCTTA No data
Right 915720672 1:157983072-157983094 GCTTAAGAGATCCTGACTCAGGG No data
915720665_915720672 3 Left 915720665 1:157983046-157983068 CCCTCTGTCCACACTGCCCAACC No data
Right 915720672 1:157983072-157983094 GCTTAAGAGATCCTGACTCAGGG No data
915720661_915720672 12 Left 915720661 1:157983037-157983059 CCCCCGCTGCCCTCTGTCCACAC No data
Right 915720672 1:157983072-157983094 GCTTAAGAGATCCTGACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915720672 Original CRISPR GCTTAAGAGATCCTGACTCA GGG Intergenic
No off target data available for this crispr