ID: 915723368

View in Genome Browser
Species Human (GRCh38)
Location 1:158000290-158000312
Sequence ACTGTTGCACACTAGTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915723368 Original CRISPR ACTGTTGCACACTAGTGCTC TGG (reversed) Intronic
904128961 1:28261348-28261370 ACTCTTGCTCTCTAGTGTTCAGG - Intronic
904862556 1:33549774-33549796 TCTGTTTCAGACTCGTGCTCAGG - Intronic
907428504 1:54396731-54396753 ACTGGTGCACACTGCTGCTCTGG + Intronic
915723368 1:158000290-158000312 ACTGTTGCACACTAGTGCTCTGG - Intronic
916284532 1:163091280-163091302 ACAGTTTCACAGTAGTGCTGAGG + Intergenic
916489308 1:165287514-165287536 ACTGGAGCATACCAGTGCTCTGG - Intronic
921069584 1:211648048-211648070 ACTGTTGCACAGTAGGACTTTGG + Intergenic
924164944 1:241271510-241271532 ACTGTTTCACAGGAGTGCCCAGG + Intronic
1063112645 10:3050000-3050022 ACTGTTTCTCACTGGTTCTCAGG - Intergenic
1066288137 10:33988490-33988512 ACTGATGAACACTAGTGCCCAGG + Intergenic
1072324175 10:94280305-94280327 TCTGTTTCACACTCTTGCTCTGG + Intronic
1073028521 10:100506359-100506381 GCTGCTGCTCACTAGTGCTAAGG - Exonic
1077504296 11:2922917-2922939 AGTGGGGCACACAAGTGCTCAGG + Intronic
1084629302 11:70335760-70335782 ACTGTTACACACGCCTGCTCAGG - Intronic
1088135214 11:106548552-106548574 ATTATTCCACACTAATGCTCTGG + Intergenic
1091504272 12:1051159-1051181 ACTGTTGCACACTTGGAATCTGG + Intronic
1091738586 12:2943444-2943466 AGTTTTGTACACTAGTGATCAGG + Intergenic
1092070959 12:5631017-5631039 TCTGCTGCACACAATTGCTCAGG - Intronic
1093569309 12:20647972-20647994 TATCTTGCACACTAGTGTTCAGG + Intronic
1103475811 12:121217891-121217913 ACTGCTGCATACTAGTCTTCAGG + Intronic
1107182439 13:37476972-37476994 ACTGTGGCACAGTGCTGCTCAGG + Intergenic
1108916539 13:55620317-55620339 ACAGTTGCACAGTTCTGCTCAGG + Intergenic
1109767100 13:66916274-66916296 CCTTTTGCACAGTAGTGATCTGG - Intronic
1114422102 14:22592886-22592908 TCTATTGCACACTGTTGCTCAGG - Intergenic
1121688501 14:95857426-95857448 AATGTTGCTCACTAGTACTTAGG - Intergenic
1122858802 14:104572911-104572933 ACTCTTGCAATCCAGTGCTCTGG - Intronic
1128802747 15:70507294-70507316 TCTGTTGCCCAGCAGTGCTCTGG + Intergenic
1131855448 15:96588714-96588736 ACTGTTGCAGACTGGTGCAGAGG + Intergenic
1134915254 16:18063942-18063964 ACTGGTGCACACTTGCCCTCAGG + Intergenic
1141775354 16:86119231-86119253 ACTTTTGCTCTCTAGGGCTCTGG - Intergenic
1149681210 17:58508596-58508618 ACTCCTGCACATTGGTGCTCTGG - Intronic
1152749915 17:82057904-82057926 ACTTTTGCACACGCGTGCTGAGG + Exonic
1154054070 18:10994433-10994455 TCTGTTGCTCTCTATTGCTCAGG + Intronic
1168102303 19:54147808-54147830 AGTGTTTCCCACTAGTCCTCTGG + Intronic
928891310 2:36206204-36206226 CCTGTTGCACACTCTTGTTCAGG - Intergenic
929157487 2:38801113-38801135 TCTGTTGGACACTGCTGCTCTGG + Intronic
930119963 2:47752479-47752501 GCTGTTGAACACTGATGCTCAGG + Intronic
932362955 2:71125025-71125047 ACTGTTGCACTCCAGCACTCCGG - Intronic
934061725 2:88300731-88300753 ACTTTTGAAAACTACTGCTCAGG + Intergenic
942323208 2:174753861-174753883 ACTGTGGGACACTACTGCTTTGG + Intronic
943647982 2:190428196-190428218 ACTGTTGCACAGTATTTCTTTGG + Intronic
947366641 2:229403295-229403317 CCTGTGGAACACTAGTTCTCAGG + Intronic
1174354949 20:49991251-49991273 ACTGTCACCCACTAGGGCTCAGG - Intergenic
1174569767 20:51493094-51493116 ACTGTTGGACCCCACTGCTCTGG - Intronic
1177404575 21:20648322-20648344 ACTGTTGAGAACTATTGCTCAGG + Intergenic
1178742835 21:35218880-35218902 ACTGTTGTAAACTAGAGCTTTGG + Intronic
1182287409 22:29256583-29256605 CCTGTTGGGCACTGGTGCTCTGG + Intronic
1183514417 22:38255711-38255733 ACTGATACACACAAGTGATCTGG + Intronic
950325310 3:12103193-12103215 ACTGTTTTACATTAGTGGTCTGG - Intronic
950700262 3:14739376-14739398 ACTGTTGAGAACTACTGCTCAGG - Intronic
953916316 3:46923171-46923193 ACTGTTGGAAACCAGTGCTGAGG - Intronic
961860739 3:129915431-129915453 ACTGTGGCAAACGAGTGCACGGG - Intergenic
966214253 3:177485496-177485518 ACTGTTGAGAACTACTGCTCGGG - Intergenic
967092548 3:186147620-186147642 CCTGCTGCACCCTAGTGCACAGG - Exonic
968672848 4:1861451-1861473 GGTGCTGCACACTGGTGCTCTGG + Intergenic
979823314 4:125201427-125201449 ACTGTTGAAAGCTACTGCTCAGG + Intergenic
980870121 4:138601575-138601597 ACTGTTGAGAACTACTGCTCAGG + Intergenic
981734402 4:147934143-147934165 AATCTTGCACACTGGTGCTTTGG - Intronic
995728147 5:115203798-115203820 TCTGTTGCACACTGCTGCTCTGG - Intergenic
996026434 5:118651296-118651318 ACTGTTGCTCACTTTTGCTGAGG - Intergenic
996104083 5:119478246-119478268 TCTGTTGCACTCTAGTGCTGAGG + Intronic
1003387710 6:5684334-5684356 AGTTTTGCATACTAGTGCGCAGG - Intronic
1008468549 6:51857436-51857458 AGTGTTGCACACTTGGGCACTGG + Intronic
1010796693 6:80124766-80124788 ACTGTTGAAACCTACTGCTCAGG - Intronic
1011856440 6:91698742-91698764 ACTGTTGGGCCCTACTGCTCAGG - Intergenic
1012524463 6:100160592-100160614 CCTGTTGCACACTTGTACTCTGG - Intergenic
1013276221 6:108587285-108587307 TCTGTTGCTCACAAGAGCTCAGG + Intronic
1014676505 6:124373674-124373696 GCTCTTGAACACTAGTGCCCTGG - Intronic
1016493364 6:144631823-144631845 ACTGAGGCATACTAATGCTCTGG + Intronic
1022859293 7:34350446-34350468 ACTGTTGCACACAATTGTCCTGG + Intergenic
1027944873 7:84732012-84732034 ACTGTTGAGAACTACTGCTCAGG - Intergenic
1030170075 7:106591873-106591895 AATGTTGGAAACTACTGCTCTGG + Intergenic
1034202874 7:149293471-149293493 ACTGTGGCACACCTGTGCTCAGG + Intronic
1039700806 8:39959784-39959806 ACAGTTTCACCCTATTGCTCAGG - Intronic
1044484929 8:92741144-92741166 ACTGCTGCACATGAGTGCTTTGG - Intergenic
1045815610 8:106272454-106272476 ACGGTTGCACACAAGATCTCAGG - Intronic
1049649581 8:143759202-143759224 ACTGCTTCACACTAGGGCTGTGG + Intergenic
1056111961 9:83405234-83405256 ACTGTTGCACACCTGGGCACTGG - Intronic
1061020441 9:128010920-128010942 ACAGTTTCACTCTATTGCTCAGG - Intergenic
1185705741 X:2265025-2265047 TCTGCTGGACACTGGTGCTCTGG - Intronic
1185705761 X:2265145-2265167 TCTGCTGGACACTGGTGCTCTGG - Intronic
1185705798 X:2265385-2265407 TCTGCTGTACACTGGTGCTCTGG - Intronic
1185705804 X:2265425-2265447 TCTGCTGGACACTGGTGCTCTGG - Intronic
1185705811 X:2265465-2265487 TCTGCTGGACACTGGTGCTCTGG - Intronic
1185705818 X:2265505-2265527 TCTGCTGGACACTGGTGCTCTGG - Intronic
1185705831 X:2265585-2265607 TCTGCTGTACACTGGTGCTCTGG - Intronic
1185705836 X:2265625-2265647 TCTGCTGTACACTGGTGCTCTGG - Intronic
1185705889 X:2265945-2265967 TCTGCTGTACACTGGTGCTCTGG - Intronic
1185705899 X:2266025-2266047 TCTGCTGTACACTGGTGCTCTGG - Intronic
1185705917 X:2266145-2266167 TCTGCTGTACACTGGTGCTCTGG - Intronic
1185705958 X:2266385-2266407 TCTGCTGTACACTGGTGCTCTGG - Intronic
1189812769 X:44796276-44796298 ATTGTTGCACAACAGAGCTCCGG - Intergenic
1190512228 X:51185181-51185203 AATCATGCACACTAGTGCCCTGG + Intergenic
1194385166 X:93243356-93243378 ACTGTTACACATTGGTGCACTGG + Intergenic
1199596483 X:149510025-149510047 ACTGCTGCACCTTAGTCCTCAGG - Intronic