ID: 915723510

View in Genome Browser
Species Human (GRCh38)
Location 1:158001530-158001552
Sequence GTGCCGTGATAGCAGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915723510 Original CRISPR GTGCCGTGATAGCAGTGTGC AGG Intronic
909274699 1:73668252-73668274 CTGCTGTGCTAGCAGTGAGCAGG + Intergenic
915723510 1:158001530-158001552 GTGCCGTGATAGCAGTGTGCAGG + Intronic
916384564 1:164252911-164252933 GTGCTGTGAGAGCTGGGTGCTGG - Intergenic
918099981 1:181364855-181364877 GTGCTTTGATAGGAGTGGGCAGG + Intergenic
1063203386 10:3807396-3807418 GGGAAGTGAAAGCAGTGTGCAGG - Intergenic
1069023912 10:63520767-63520789 GTGCAGTGATACCACTGTTCTGG - Intergenic
1073758026 10:106601922-106601944 GTACCCTGAAAGCAGTGGGCTGG + Intronic
1076702239 10:132279862-132279884 GTGGCGTGATCACAGAGTGCAGG - Intronic
1076702382 10:132280578-132280600 GTGGCGTGATCACAGGGTGCAGG - Intronic
1084398372 11:68929676-68929698 GTGCCGTGAGAGCCTTGGGCTGG + Intronic
1085542805 11:77288290-77288312 TGGCAGTGTTAGCAGTGTGCAGG - Intronic
1098473626 12:70873860-70873882 GTGTTGTGATAGCAGTATGTGGG + Intronic
1102986695 12:117284258-117284280 ATGCCGTGGCAGCAGTGAGCGGG + Intronic
1114022470 14:18492950-18492972 AGACCGTCATAGCAGTGTGCTGG - Intergenic
1124578152 15:30927540-30927562 GTGCTGTGAGAGCAGAGGGCAGG - Intronic
1125752587 15:42038707-42038729 GAGGCTTGAAAGCAGTGTGCGGG + Intronic
1131401315 15:92127910-92127932 GTGCAGGCATAGCAGTGTTCAGG + Intronic
1134879569 16:17733533-17733555 CTGCTGTGCTAGCAGTGAGCAGG - Intergenic
1136019699 16:27432210-27432232 GTGGAGTGATAGCCATGTGCGGG + Intronic
1137708129 16:50548988-50549010 GTGCCGTGAGAGCCGAGGGCAGG - Intronic
1138997438 16:62472601-62472623 GTGTGGTGACTGCAGTGTGCTGG + Intergenic
1143322453 17:6076918-6076940 CTGCCCTGCTAGCTGTGTGCTGG + Intronic
1143509205 17:7386291-7386313 GTGGAGTGAAAGCAGTGTACAGG + Intronic
1144721160 17:17470774-17470796 GAGCCGTGGCATCAGTGTGCGGG - Intergenic
1144730873 17:17525545-17525567 GAGCAGTGAGAGCAGAGTGCTGG - Intronic
1151427277 17:74039180-74039202 CTGCCCTGAAAGCAGTGGGCAGG - Intergenic
1151513628 17:74578251-74578273 GTGCCGTGAAGGCAGTCTACAGG - Intergenic
1151804304 17:76396193-76396215 GTGCTGTGCCAGCAGTGTGGCGG - Exonic
1159565709 18:70046326-70046348 GTGCAGTGAGGGCAGTGTGCTGG - Intronic
1159711870 18:71770496-71770518 GTGCTATGATAGCATTGTCCAGG + Intronic
1159724197 18:71933477-71933499 GTGCAGTGAGAGCAGTGAGAAGG + Intergenic
1168725326 19:58578116-58578138 GTGCCCTGAGAGCAGTGAGGAGG + Intergenic
930868179 2:56142886-56142908 CTGCTGTGCTAGCAGTGAGCGGG + Intergenic
935350329 2:102146998-102147020 GTGCCGAGATAGCAGGGCACCGG + Intronic
939071986 2:137554937-137554959 CTGCTGTGCTAGCAGTGAGCGGG - Intronic
941120129 2:161519725-161519747 ATGCAGTGAAAGCAGTGTTCAGG - Intronic
1169412490 20:5383345-5383367 CAGCGGTGATAGCAGTGGGCTGG - Intergenic
1174787254 20:53444460-53444482 GTGCCGGTACTGCAGTGTGCTGG + Intronic
1180025816 21:45161487-45161509 GTGCCGAGGCAGCAGGGTGCTGG - Intronic
1180446513 22:15419364-15419386 AGACCGTCATAGCAGTGTGCTGG - Intergenic
1181337029 22:22144454-22144476 GAGCCAAGAAAGCAGTGTGCAGG - Intergenic
1184955865 22:47885552-47885574 GGGCTGTGATAGCCGTGTGCAGG - Intergenic
1185244379 22:49765457-49765479 GGGCCATGATAGCAGGGTCCTGG - Intergenic
963328582 3:143889516-143889538 GAGATGTGGTAGCAGTGTGCTGG + Intergenic
968244460 3:197128765-197128787 GAGCTATGATGGCAGTGTGCAGG - Intronic
969424427 4:7115934-7115956 GTGACGTGAGCGCAGTGTGGAGG + Intergenic
970337680 4:15067560-15067582 GTGACTGGTTAGCAGTGTGCTGG - Exonic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
972685607 4:41349821-41349843 CTGCTGTGCTAGCAGTGAGCGGG - Intergenic
981831126 4:149003455-149003477 GTGCCATGATAGCGATGTGTGGG + Intergenic
983474648 4:168198733-168198755 CTGCTGTGCTAGCAGTGAGCAGG + Intergenic
990120789 5:52448915-52448937 TTTCTGTGACAGCAGTGTGCAGG - Intergenic
995020571 5:107362553-107362575 GTGCCATGATAGTAATTTGCTGG + Intergenic
998681014 5:144467564-144467586 GTGCCGTGAAAGCAACGGGCAGG + Intronic
999339756 5:150759882-150759904 GTCTCGTGATAGCTGAGTGCAGG + Intergenic
1004730330 6:18351644-18351666 GTGCTGTGAAAGCACTTTGCTGG - Intergenic
1008252356 6:49255838-49255860 CTGCCGTGAAAGAAGTATGCTGG + Intergenic
1008569236 6:52799261-52799283 CTGCCATGATAGCAGTCTCCTGG + Exonic
1008573903 6:52840807-52840829 CTGCCATGATAGCAGTCTCCTGG + Exonic
1015849087 6:137553034-137553056 ATGAAGTGGTAGCAGTGTGCAGG + Intergenic
1023873264 7:44274004-44274026 AGGGCCTGATAGCAGTGTGCGGG - Intronic
1024320771 7:48066586-48066608 ATGCAGTGATAGCAGTGGTCAGG - Intergenic
1042334412 8:67615061-67615083 GTGCCCTGATACCAGTGATCAGG + Intronic
1044440844 8:92221814-92221836 GTGCTGTGCTAGCAGTGATCGGG + Intergenic
1048811218 8:138288398-138288420 GTGCTGTGAGGGAAGTGTGCAGG + Intronic
1049059222 8:140263247-140263269 GTCCCGTGATAGCAGTGGGCAGG - Intronic
1050387000 9:5101268-5101290 CTGCTGTGCTAGCAGTGAGCAGG - Intronic
1059960447 9:119559482-119559504 GTGCAGAGTTAGCAATGTGCTGG + Intergenic
1061014958 9:127976173-127976195 TTGCCTTGATGGCAGTGGGCCGG - Intronic
1062546991 9:137068338-137068360 GTCCCCAGATAGCAGCGTGCTGG + Intronic
1191828281 X:65389385-65389407 CTGCTGTGCTAGCAGTGAGCGGG + Intronic
1192630053 X:72770207-72770229 GAGCAGTGTTAGCAATGTGCAGG - Intergenic
1192651657 X:72950597-72950619 GAGCAGTGTTAGCAATGTGCAGG + Intergenic
1193668761 X:84357036-84357058 GTGCCATGACAACAGTGTTCAGG - Intronic
1201953013 Y:19586205-19586227 CTGCTGTGCTAGCAGTGAGCCGG + Intergenic