ID: 915724297

View in Genome Browser
Species Human (GRCh38)
Location 1:158006934-158006956
Sequence CACCCTGGCAAGGCGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 146}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915724297_915724305 11 Left 915724297 1:158006934-158006956 CCTTGTCCCGCCTTGCCAGGGTG 0: 1
1: 0
2: 0
3: 15
4: 146
Right 915724305 1:158006968-158006990 ATAGCAGTGTAAGCAGAGAGAGG 0: 1
1: 1
2: 1
3: 21
4: 258
915724297_915724312 29 Left 915724297 1:158006934-158006956 CCTTGTCCCGCCTTGCCAGGGTG 0: 1
1: 0
2: 0
3: 15
4: 146
Right 915724312 1:158006986-158007008 AGAGGAGGGGATGGGGTCTGTGG 0: 1
1: 0
2: 6
3: 135
4: 1044
915724297_915724307 15 Left 915724297 1:158006934-158006956 CCTTGTCCCGCCTTGCCAGGGTG 0: 1
1: 0
2: 0
3: 15
4: 146
Right 915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG 0: 1
1: 0
2: 3
3: 48
4: 674
915724297_915724313 30 Left 915724297 1:158006934-158006956 CCTTGTCCCGCCTTGCCAGGGTG 0: 1
1: 0
2: 0
3: 15
4: 146
Right 915724313 1:158006987-158007009 GAGGAGGGGATGGGGTCTGTGGG 0: 1
1: 1
2: 11
3: 69
4: 645
915724297_915724311 22 Left 915724297 1:158006934-158006956 CCTTGTCCCGCCTTGCCAGGGTG 0: 1
1: 0
2: 0
3: 15
4: 146
Right 915724311 1:158006979-158007001 AGCAGAGAGAGGAGGGGATGGGG 0: 1
1: 1
2: 16
3: 236
4: 1723
915724297_915724306 14 Left 915724297 1:158006934-158006956 CCTTGTCCCGCCTTGCCAGGGTG 0: 1
1: 0
2: 0
3: 15
4: 146
Right 915724306 1:158006971-158006993 GCAGTGTAAGCAGAGAGAGGAGG 0: 1
1: 0
2: 2
3: 31
4: 424
915724297_915724310 21 Left 915724297 1:158006934-158006956 CCTTGTCCCGCCTTGCCAGGGTG 0: 1
1: 0
2: 0
3: 15
4: 146
Right 915724310 1:158006978-158007000 AAGCAGAGAGAGGAGGGGATGGG 0: 1
1: 1
2: 12
3: 135
4: 1436
915724297_915724309 20 Left 915724297 1:158006934-158006956 CCTTGTCCCGCCTTGCCAGGGTG 0: 1
1: 0
2: 0
3: 15
4: 146
Right 915724309 1:158006977-158006999 TAAGCAGAGAGAGGAGGGGATGG 0: 1
1: 2
2: 16
3: 166
4: 1617
915724297_915724308 16 Left 915724297 1:158006934-158006956 CCTTGTCCCGCCTTGCCAGGGTG 0: 1
1: 0
2: 0
3: 15
4: 146
Right 915724308 1:158006973-158006995 AGTGTAAGCAGAGAGAGGAGGGG 0: 1
1: 1
2: 1
3: 65
4: 823

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915724297 Original CRISPR CACCCTGGCAAGGCGGGACA AGG (reversed) Intronic
900566936 1:3338199-3338221 GACCCTCGCAAGGCAGGAGAAGG + Intronic
901771933 1:11534993-11535015 CACCCCTGCAAGGGAGGACAGGG - Exonic
902447442 1:16476156-16476178 CTCCCAGGCAATGAGGGACAGGG + Intergenic
903178307 1:21593303-21593325 CCCCTTGGCAAGGCGGGAGCAGG + Intergenic
904376302 1:30084561-30084583 CACACTGGGAAGTCGGGGCAGGG - Intergenic
904672887 1:32179592-32179614 CGCCCCGGCAGGGCGGGGCAGGG - Intergenic
906207638 1:43995660-43995682 CACCCTGGCAGGTGAGGACACGG + Exonic
907656044 1:56342699-56342721 CACCCAGCCAAGGAGGGACAGGG + Intergenic
910551998 1:88486053-88486075 CACCCAGGCAATGTGGGAAAAGG + Intergenic
910667860 1:89743504-89743526 CACCCTGGGACGGCTTGACACGG + Intronic
911424067 1:97684773-97684795 CACCCTCCCAAGGCTGAACAAGG + Intronic
912893556 1:113561044-113561066 CACCCTGTCAAGGCTGAACCAGG + Intronic
915724297 1:158006934-158006956 CACCCTGGCAAGGCGGGACAAGG - Intronic
919986963 1:202682104-202682126 CTCACTGGCAAGGCAAGACAGGG - Intronic
920861298 1:209709552-209709574 CACCCTGGAAAGGCAGTCCAGGG + Intronic
920969594 1:210731847-210731869 CACCCTGCCAAGCTGGGAGAAGG - Intronic
921956123 1:220984454-220984476 CACCCTCGCAGGGCGTGAGATGG - Intergenic
922447621 1:225711008-225711030 CACCTTGGCAAGGCAAGTCAGGG + Intergenic
1065324049 10:24535035-24535057 CACCTTCTCAAGGCAGGACAAGG + Intronic
1067278590 10:44854892-44854914 CACCCAGAAAAGGCGGGAGAGGG + Intergenic
1068113826 10:52713867-52713889 CAGCCTGGCTAGGAGGGTCAGGG + Intergenic
1069560467 10:69425777-69425799 CACCTGGGCAAGGAGGGGCAAGG - Intergenic
1070130652 10:73653325-73653347 CACCCTGGCTGGGAGGGCCAGGG + Exonic
1070620641 10:78007718-78007740 CAGCCTGGCGAGCCGTGACATGG + Exonic
1070644241 10:78190428-78190450 CACCATGTCAAGGCTGGGCAAGG + Intergenic
1072860127 10:98994843-98994865 CACTCTGCCAAGGAGGGACAGGG - Intronic
1074109288 10:110411025-110411047 CACACTGGAATGGAGGGACAAGG + Intergenic
1075062172 10:119264808-119264830 CACCCTGGCCAGGAGGAAAAGGG - Intronic
1082014165 11:47471872-47471894 CACCCTGGGGAAGGGGGACAGGG - Intronic
1083280165 11:61622093-61622115 CACACGGGCAAGGCAGGAAAAGG - Intergenic
1086473743 11:87147074-87147096 CACTCTGGGAAGCCGAGACAGGG + Intronic
1087027207 11:93661574-93661596 CCCCCGAGGAAGGCGGGACAGGG + Intergenic
1088868922 11:113875324-113875346 CGCCCCGGCCGGGCGGGACAGGG - Intronic
1092295024 12:7190374-7190396 CACCATGGCAATGCGGGAGCTGG + Exonic
1093164617 12:15790049-15790071 CAGCCTGGCGAGGCGGGTCTGGG - Intronic
1108232521 13:48363258-48363280 TACCCTGCCAAGGCTGGGCATGG + Intronic
1108698825 13:52926485-52926507 CATCTTGGCAAGGCGGGGCATGG - Intergenic
1110655107 13:77988553-77988575 ACCCCTGCCAAGGCAGGACAGGG + Intergenic
1115782360 14:36783639-36783661 CACCTTGGGAAAGGGGGACATGG + Intronic
1116754121 14:48924555-48924577 AACCCTGGCATGGCTGGCCATGG - Intergenic
1119479116 14:74948767-74948789 CTCCCGGGCAGGGAGGGACAGGG - Intronic
1119783578 14:77295952-77295974 CACCATGGAGAGGTGGGACATGG + Intronic
1122574138 14:102731254-102731276 CACGCTGGGAAGGCTGGACCCGG - Intergenic
1122954819 14:105065703-105065725 CAGACAGGCAAGGCAGGACAGGG + Intergenic
1124365549 15:29068699-29068721 CACCCAGGCAAAGTGGGAGATGG - Intronic
1125754888 15:42056953-42056975 CACCCTGGCAGGGCCGGCCTTGG + Intergenic
1131177830 15:90220996-90221018 CACCCTGGCAAGGGACGAGAAGG + Exonic
1132867858 16:2102776-2102798 CAGCCTGGCAGGGCAGGGCAGGG - Intronic
1140034191 16:71360170-71360192 CACCCTGCCAAGGCGAGGAAGGG - Intronic
1141700623 16:85640448-85640470 CACCAGGGGAAGGCGGCACAGGG - Intronic
1142239407 16:88938333-88938355 CGCCCGGGCAGGGCTGGACAGGG + Intronic
1142696580 17:1637119-1637141 CACCTTGGCAGGGTGTGACAGGG + Intronic
1142741851 17:1936222-1936244 CACTCTGGCAAGGTGGGAAAAGG - Exonic
1143321279 17:6070592-6070614 CGCCCGGGGAAGGCGGGCCATGG + Intronic
1144769846 17:17753327-17753349 AACCCTGTCAAGCCAGGACAAGG - Intronic
1146317574 17:31820309-31820331 CACACAGGCGAGGCAGGACAGGG - Intergenic
1146654844 17:34629001-34629023 TACCCTGGCAGGGAGGGCCAGGG + Exonic
1148759181 17:49990682-49990704 CACCCTTGCAAGGGGAGACTTGG + Exonic
1148790117 17:50168131-50168153 CATCCTGGAAAGTGGGGACAAGG + Intronic
1149116204 17:53098829-53098851 CACCTAGGCAAGGTGGGAGAGGG + Intergenic
1149127597 17:53254564-53254586 CATCCTGGCAAAGTGGCACAGGG - Intergenic
1150517804 17:65832631-65832653 CATCCTGCCAAGGCTGAACAAGG + Intronic
1150569969 17:66376863-66376885 CACCCTGGAAAGGCAAGTCAAGG + Intronic
1152636320 17:81431934-81431956 CACCCAGGCACCGCAGGACAGGG + Intronic
1157668754 18:49510898-49510920 CACCCTGGGGAGCAGGGACAGGG - Intergenic
1159893128 18:73971842-73971864 CTCCCTGGCAACGGGGGAAACGG + Intergenic
1160113369 18:76054743-76054765 CCCCCTGTCAAGGTGGGACAGGG + Intergenic
1160944011 19:1632885-1632907 CACACTGGCAGGTGGGGACAGGG - Intronic
1161979837 19:7624620-7624642 CACCCTGGCAGTGCAGGGCAGGG - Intronic
1162371292 19:10281161-10281183 CAGCCTGGCCAGGCCAGACATGG - Intronic
1162567236 19:11451148-11451170 GACCCAGGGAAGGTGGGACACGG - Intergenic
1162737689 19:12755595-12755617 CACCTGGGCAGGGCGGGGCAGGG - Exonic
1165090680 19:33386778-33386800 CAGACTGGCCTGGCGGGACAAGG - Intergenic
1165374181 19:35430007-35430029 CAGCCTGGGTAGGCGGGAGAAGG - Intergenic
1165831162 19:38731076-38731098 CACCCCGGCATGGTGGGGCATGG - Exonic
1166177117 19:41082028-41082050 CACCTGGCCAAGGAGGGACAGGG - Intergenic
1166675444 19:44738042-44738064 CACCCTGGCAGGGTGGAGCATGG - Intergenic
1167611260 19:50508663-50508685 GACCCTGGGCAGGCAGGACATGG + Intronic
1168335317 19:55593833-55593855 CACCATGGCCAGCCAGGACATGG - Intronic
1168697483 19:58412497-58412519 CACCCTGGCCAGGCCGGGCGTGG - Intronic
925379859 2:3417203-3417225 CACCCAGGGCAGGCCGGACATGG - Intronic
926733046 2:16051539-16051561 TTCCCTGGCAAGGAGGGACGGGG - Intergenic
928157193 2:28887642-28887664 TAGCCTGGCATGGAGGGACAGGG - Intergenic
933672955 2:85026731-85026753 CACTTTGGCAAGGCGAGGCAGGG - Intronic
937498407 2:122450337-122450359 CACCCAGCCAAAGAGGGACAGGG + Intergenic
941666172 2:168246563-168246585 CACCCTGGCACGGAGGGAGGCGG + Intronic
941858553 2:170254637-170254659 CACCCTGGGAAGTTGGGACAAGG - Intronic
942164430 2:173228321-173228343 AAACCTGGCATGGCGGGAGAGGG - Intronic
945290683 2:208124355-208124377 CTGCAAGGCAAGGCGGGACAAGG + Intronic
946237166 2:218331083-218331105 CATCCTGGGAAGGTGGGACGGGG + Intronic
947118935 2:226797713-226797735 CACCGAGGCTGGGCGGGACATGG + Exonic
947327110 2:228991530-228991552 CAGCCTGGCAAGGCTGCACTTGG + Intronic
947790782 2:232867657-232867679 CACCCTGGGGAGGCAGGACGAGG - Intronic
1171494747 20:25548097-25548119 CCCCATGGCAAGGAGGGACAGGG - Intronic
1172520905 20:35564915-35564937 GATCCTGGCAAGGAGGGAGAGGG + Intergenic
1176842152 21:13850091-13850113 GACCCTGGAAAAGCGGGACCTGG + Intergenic
1178327509 21:31657736-31657758 CAGCCTGGCAGGGAGGGACAGGG + Intergenic
1179023995 21:37665307-37665329 CTCCCTGGCAAGGCAGGCCATGG + Intronic
1179251353 21:39673910-39673932 CACCATGAGAGGGCGGGACAAGG - Intergenic
1180874757 22:19169989-19170011 CACCCGGCCAAGGCGGGCCTTGG + Intergenic
1180987273 22:19912344-19912366 CACCCTGGGAGGGCGTGGCAGGG + Intronic
1181493042 22:23272759-23272781 CACCCTGGCAAGGACGGGCTGGG - Intronic
1181646347 22:24233377-24233399 CTCCCTGGCACGGGGGGACACGG - Intronic
1181798346 22:25326920-25326942 AACCCTGGCACGGCCGGGCACGG - Intergenic
1182070788 22:27462314-27462336 CAGCCTGGCCAGGAGGGCCAGGG + Intergenic
1182518084 22:30870240-30870262 CACCCTGGGAAGGCTGGGCCAGG + Intronic
1182634469 22:31713476-31713498 CACCCTAGCAAAGCTGGCCAAGG - Exonic
1183192724 22:36332025-36332047 CATCCTGGCAACGCAGGGCAGGG - Intronic
1184121316 22:42452397-42452419 CACCCTGGCCAGGCAGGGCCTGG - Intergenic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
1184927396 22:47652810-47652832 CAGCCAGGCAAGGCAGGACGTGG + Intergenic
949780309 3:7679282-7679304 AACCCTGGGAAGGCAAGACAGGG + Intronic
952805225 3:37343409-37343431 CAGCCTGGCCAGGCTGGGCACGG - Intronic
953171795 3:40513892-40513914 CACTCTGTCAAGCCGGGACAGGG + Intronic
953201195 3:40780077-40780099 CTCCCTGGCAAGGAGGAGCAGGG + Intergenic
966928676 3:184661836-184661858 CAGCCTGGCCAGGCCGGGCACGG - Intronic
970356364 4:15257325-15257347 CACTCTGGCCAAGAGGGACAGGG - Intergenic
973394030 4:49578663-49578685 GACCCTGGAAAAGCGGGACCTGG - Intergenic
980322879 4:131302461-131302483 CACCCGGCCAAGGAGGGAGAAGG + Intergenic
1202764089 4_GL000008v2_random:136273-136295 GACCCTGGAAAAGCGGGACCAGG + Intergenic
985827015 5:2200033-2200055 CACGCTGGCAAGGAAGGCCAGGG + Intergenic
985878645 5:2620134-2620156 CACCCTGGCAAGAGGGGCCTTGG - Intergenic
988534041 5:32050219-32050241 CAGCCTGACAAGGCCGGGCACGG - Intronic
990878296 5:60511257-60511279 CACCATGGCAGGGCTGGGCATGG - Intronic
992080265 5:73230274-73230296 AAGCCTGGGTAGGCGGGACAGGG + Intergenic
992386005 5:76285143-76285165 CACCCTGGAAAAGGAGGACACGG - Exonic
992507585 5:77403283-77403305 CACCCTGGAAAATAGGGACAAGG + Intronic
992563139 5:77972556-77972578 CACCGAGTCAACGCGGGACACGG + Intergenic
998097444 5:139404147-139404169 CACCCTGGCAACGGGGGGCGGGG + Intergenic
1001064944 5:168529175-168529197 ATCCCTGGGAAGGCGGGAGATGG + Exonic
1002106096 5:176880061-176880083 CAGCCTGGCTAGGCAGGCCATGG - Exonic
1006893174 6:37447399-37447421 CAGACTGGCAATGCGGAACAGGG + Intronic
1018867864 6:167759564-167759586 CAGCCTGACCAGGCGGGAGATGG + Intergenic
1022632150 7:32095364-32095386 CACCCTTCCATGGCCGGACATGG + Intronic
1028900349 7:96092589-96092611 CACCCAGGCAAGGCGAGCAAGGG + Intronic
1029505970 7:100964500-100964522 CTGCCTGGGAAGGCAGGACAAGG - Intronic
1032474899 7:132204948-132204970 CTCCCTGGCAACGCGTGCCAGGG + Intronic
1035209723 7:157318850-157318872 CACCGTGCCCAGCCGGGACATGG - Intergenic
1035622011 8:1042186-1042208 CTCCCTGGGAAAGCCGGACAAGG - Intergenic
1036286693 8:7449089-7449111 CACCCTGGCAGGGAGGGACGGGG + Intronic
1036334785 8:7862434-7862456 CACCCTGGCAGGGAGGGACGGGG - Intronic
1038252978 8:25923436-25923458 CACCCTGGCAAGCTGAGAGATGG - Intronic
1040009969 8:42653134-42653156 AGCCCTGGCAAGGTGGGGCAAGG + Intergenic
1040422243 8:47251557-47251579 GACCCTGGGATGGTGGGACATGG + Intergenic
1040455495 8:47593810-47593832 CACCCTGGCTGGGAGGGCCAGGG + Intronic
1042376832 8:68061495-68061517 CACCCAGGAGTGGCGGGACAAGG + Intronic
1042813721 8:72854793-72854815 CACCGTGGCAGGAGGGGACATGG + Intronic
1045474768 8:102543404-102543426 GAACCTGGCAATGGGGGACATGG - Intergenic
1045500025 8:102738088-102738110 AACCCTGGCAATGTGGGACTGGG + Intergenic
1047325780 8:123834603-123834625 GCCCCTTGCAAGTCGGGACAGGG - Intergenic
1049554644 8:143275831-143275853 CACCGTGGCACGGAGGGACGGGG - Intronic
1049564298 8:143330295-143330317 CTCCCTGGCCAGGAGGGACATGG - Intronic
1049585187 8:143429766-143429788 CACCATGGCGGCGCGGGACACGG - Exonic
1050464357 9:5905709-5905731 CAGCCTGAAAAGGCAGGACATGG - Intronic
1058463578 9:105206420-105206442 CAGCCTAGCAAGGCAGGGCAGGG - Intergenic
1059706245 9:116826175-116826197 CACCCAGTCAAGGAGGGACAGGG + Intronic
1062242540 9:135548058-135548080 CGCCCTGGCACGGGGGGAAAAGG + Intronic
1188427631 X:30067536-30067558 CACCCACCCAAGGAGGGACAAGG + Intergenic
1199256455 X:145723751-145723773 AAGCCTGGCAGGGCAGGACAGGG - Intergenic
1199478556 X:148273303-148273325 CACTCTGGTAAGGTGGGAGATGG + Intergenic
1199689389 X:150296860-150296882 GACCCTGGTAAGGAGGTACAGGG - Intergenic
1199720011 X:150536724-150536746 CACCCTGGGAAGCCTGGACTGGG - Intergenic