ID: 915724307

View in Genome Browser
Species Human (GRCh38)
Location 1:158006972-158006994
Sequence CAGTGTAAGCAGAGAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 726
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 674}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915724299_915724307 9 Left 915724299 1:158006940-158006962 CCCGCCTTGCCAGGGTGGATCCC 0: 1
1: 0
2: 0
3: 17
4: 251
Right 915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG 0: 1
1: 0
2: 3
3: 48
4: 674
915724297_915724307 15 Left 915724297 1:158006934-158006956 CCTTGTCCCGCCTTGCCAGGGTG 0: 1
1: 0
2: 0
3: 15
4: 146
Right 915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG 0: 1
1: 0
2: 3
3: 48
4: 674
915724301_915724307 5 Left 915724301 1:158006944-158006966 CCTTGCCAGGGTGGATCCCAAGA 0: 1
1: 0
2: 1
3: 9
4: 139
Right 915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG 0: 1
1: 0
2: 3
3: 48
4: 674
915724302_915724307 0 Left 915724302 1:158006949-158006971 CCAGGGTGGATCCCAAGAGATAG 0: 1
1: 0
2: 0
3: 6
4: 94
Right 915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG 0: 1
1: 0
2: 3
3: 48
4: 674
915724300_915724307 8 Left 915724300 1:158006941-158006963 CCGCCTTGCCAGGGTGGATCCCA 0: 1
1: 0
2: 0
3: 19
4: 180
Right 915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG 0: 1
1: 0
2: 3
3: 48
4: 674

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915724307 Original CRISPR CAGTGTAAGCAGAGAGAGGA GGG Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900508657 1:3044878-3044900 GAGTGGAAGGAGGGAGAGGATGG - Intergenic
900610267 1:3541748-3541770 CAGTGGCAGCAGAGAGTGGGCGG + Intronic
900722368 1:4185662-4185684 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
900847659 1:5116411-5116433 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
901145911 1:7064564-7064586 CAGTTTAAGCTGAGATGGGAAGG + Intronic
902936613 1:19769319-19769341 CAAGGAGAGCAGAGAGAGGAGGG - Intronic
903459461 1:23510240-23510262 CAGGCTAAGGAGAGAGAAGAAGG - Intronic
903885299 1:26537486-26537508 CAGGGGAAGCAGAGATAGCAGGG - Intronic
903906424 1:26690722-26690744 CAGTGTAAGCACAGACAAAATGG - Intergenic
904265019 1:29313168-29313190 GGGAGAAAGCAGAGAGAGGAGGG - Intronic
904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG + Intergenic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
904974300 1:34444026-34444048 CAATGGAAGCAGAGAGTGGAGGG - Intergenic
904996309 1:34634377-34634399 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
905014236 1:34766227-34766249 GAGTCTAAGCTGAGAAAGGAGGG - Intronic
905461952 1:38127870-38127892 CAGTCAAAGCAGAGTGAAGAAGG - Intergenic
905499957 1:38428359-38428381 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
905703181 1:40034645-40034667 AAGTGTAAGTAGAGAAAGAAGGG + Intergenic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906259669 1:44377539-44377561 CAGAGTACGGAGAGAGAGGGAGG + Intergenic
906378877 1:45318839-45318861 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
906744343 1:48211402-48211424 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
907503399 1:54900288-54900310 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
907568970 1:55465650-55465672 CAATGTAAGCACAGAGCAGATGG - Intergenic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
908840770 1:68278040-68278062 CTGTGTCAGCTGAGAGAGGGAGG - Intergenic
909035645 1:70591586-70591608 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
909072131 1:71007511-71007533 CCCTGGAAGCAAAGAGAGGAAGG - Intronic
909214703 1:72871615-72871637 CAGAATAGGCAGAGAGAAGATGG - Intergenic
909222492 1:72982261-72982283 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
909342858 1:74551078-74551100 CAGAGTGAGAAGGGAGAGGAGGG - Intergenic
909510611 1:76448061-76448083 CAGTGCAAGCAGAGAGGAGGGGG + Intronic
909532928 1:76700848-76700870 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
912285589 1:108365157-108365179 GAGTGGGAGCAGAAAGAGGAAGG - Intergenic
912813744 1:112812721-112812743 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
913064753 1:115240347-115240369 CACAGTGAGCACAGAGAGGAAGG - Intergenic
913106065 1:115615152-115615174 TGGAGTGAGCAGAGAGAGGATGG - Intergenic
913113192 1:115674116-115674138 CAGTGTGAGCAGAAACAGGCTGG - Intronic
913495468 1:119424301-119424323 CATTGTAAGCAAAAACAGGATGG + Intergenic
915507115 1:156364855-156364877 CAGGGTAGGAAGAGACAGGATGG - Intronic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915732461 1:158063735-158063757 CCTGGTAAGCAGAGAGAGAAGGG - Intronic
915795471 1:158728482-158728504 CAGTGAAATATGAGAGAGGAAGG + Intergenic
915816603 1:158973715-158973737 AAGTGTCAGAAGAAAGAGGAGGG - Exonic
916452152 1:164931104-164931126 GAGTGAGAGCAGAGAGAGTAGGG - Intergenic
916791472 1:168129131-168129153 CAGGGTAAGCAGAGAGGGAATGG + Intronic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
918347295 1:183616938-183616960 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
918697823 1:187565954-187565976 CAGTGGAGGCAGAGATAGGGAGG + Intergenic
919476578 1:198038066-198038088 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
920425579 1:205872512-205872534 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
920783756 1:209020553-209020575 CAGTGAAAGCAGCCAGAAGAGGG + Intergenic
921365213 1:214367345-214367367 CACTGAAAGCAGAGAGTAGAAGG - Intronic
921459598 1:215412365-215412387 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
921509435 1:216011287-216011309 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
921621872 1:217334301-217334323 CAGTGTATGAGGGGAGAGGAAGG - Intergenic
921759713 1:218899048-218899070 AAGAGCAGGCAGAGAGAGGAAGG - Intergenic
922048584 1:221969231-221969253 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
922049359 1:221975525-221975547 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
922153884 1:223026829-223026851 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922363362 1:224842879-224842901 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
922894342 1:229088771-229088793 CAAGGTAAGGAGAAAGAGGAGGG + Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923244928 1:232121469-232121491 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
923257163 1:232232055-232232077 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
923408448 1:233685855-233685877 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
923521349 1:234737449-234737471 CAGTGACAGCAGAGAGGGGTGGG + Intergenic
923736985 1:236619505-236619527 AAGGGCAAGCGGAGAGAGGAAGG + Intergenic
923770565 1:236934686-236934708 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
923962957 1:239104652-239104674 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1063363333 10:5474397-5474419 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1063612804 10:7577016-7577038 CAGTGGAAGCACAGGGAGGGAGG + Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1064961501 10:20970167-20970189 TTGTGTGAGCAGAGCGAGGATGG + Intronic
1065309111 10:24396983-24397005 GAGTGTTAGCAGAGTGAGCAGGG + Intronic
1065930989 10:30479013-30479035 CAGTGTGAGGAGAGTCAGGAGGG - Intergenic
1065991080 10:31011151-31011173 CAGGCTGAGCAGAGAGAGCATGG + Intronic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1067133413 10:43586778-43586800 CTGTGTTAGCAGAGACAAGAAGG - Intergenic
1067462823 10:46470429-46470451 AAGTGGAAGGAGAGAGAGGTTGG - Intergenic
1067624371 10:47914208-47914230 AAGTGGAAGGAGAGAGAGGTTGG + Intergenic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068360948 10:55974485-55974507 AAGTGAAAGCACAGAGAGGCTGG - Intergenic
1069622674 10:69847493-69847515 CAGAGTAGGGAGAGAGATGAGGG - Intronic
1069837683 10:71319462-71319484 GAGAGCAAGGAGAGAGAGGAGGG - Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1071805840 10:89119893-89119915 GAGTGAAAGGAGAGTGAGGAGGG - Intergenic
1071897564 10:90083462-90083484 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1071916374 10:90298282-90298304 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1072180755 10:92977245-92977267 CATTCCAAGCAGAGAGAGGATGG - Intronic
1072528643 10:96297509-96297531 CATTGTAAAAGGAGAGAGGATGG - Intergenic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1074258097 10:111824020-111824042 CAGTGCAAGCAAACAGAGGTTGG + Intergenic
1074322906 10:112420211-112420233 CAGAGTTGGGAGAGAGAGGAAGG - Intronic
1075014009 10:118896840-118896862 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1075248877 10:120848129-120848151 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1077612368 11:3651226-3651248 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1077850624 11:6072258-6072280 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1078090484 11:8261915-8261937 GTGTGTAGGAAGAGAGAGGATGG - Intronic
1078249721 11:9607141-9607163 CAGTTAAAGCAGAAAGTGGAGGG + Intergenic
1078717282 11:13852239-13852261 CAGTGTGAGCCTAGAGAGAACGG - Intergenic
1080683355 11:34496060-34496082 GGGTGGAAGCAGAGAGGGGAGGG - Intronic
1080922327 11:36721463-36721485 CAGTGAGAGCAGTGAGAGAAGGG - Intergenic
1080994310 11:37581133-37581155 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1081356987 11:42123866-42123888 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1082069042 11:47923864-47923886 CAGTGTCCACAGAGAGAGCAGGG - Intergenic
1082196180 11:49308966-49308988 CAGTGTAATGGGAGAGAGAATGG + Intergenic
1083474011 11:62904032-62904054 CAGTTAAAGCAGAGAGAGGCCGG - Intergenic
1083534583 11:63456195-63456217 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1083745066 11:64730906-64730928 CAGTGTCTGCACAGATAGGAGGG + Intronic
1085065097 11:73488016-73488038 CAGTGTTGGCAGAGAGTAGACGG - Intronic
1085129496 11:74025967-74025989 AAGGGAAAGCACAGAGAGGAAGG + Intronic
1085786984 11:79461450-79461472 AAATGTAATCAGAGAGGGGAGGG - Intergenic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1086550390 11:88046472-88046494 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1086659645 11:89399241-89399263 CAGTGTAATGGGAGAGAGAATGG - Intronic
1087127988 11:94644893-94644915 AAGTGAAAGCGAAGAGAGGATGG - Intergenic
1087207987 11:95417192-95417214 CAATGGAAGCAGAGATAGTATGG - Intergenic
1087676690 11:101170872-101170894 CTGTGATGGCAGAGAGAGGAAGG + Intergenic
1087839366 11:102906506-102906528 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1087839871 11:102909600-102909622 CAGTGAAAGGAGATAGAGGTGGG + Intergenic
1088523607 11:110727314-110727336 CAATGTAAGCAAGGAGAGAATGG - Intergenic
1089342968 11:117772123-117772145 GGGTGTCAACAGAGAGAGGAGGG + Intronic
1089606542 11:119644730-119644752 CATTGTAGGCAGAGTGAGGAGGG + Intronic
1089641685 11:119851816-119851838 CAGTGCAAGCTGAGAGAACAGGG - Intergenic
1089644488 11:119869660-119869682 AGGTCTAGGCAGAGAGAGGATGG - Intergenic
1089814352 11:121159014-121159036 CACTGTGAGCACAGAGAGGCAGG + Intronic
1089928856 11:122288131-122288153 CAATTTCAGCAGTGAGAGGAGGG + Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090107426 11:123868015-123868037 AAGTGAAAGCAGAGAGAGGCTGG + Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090450059 11:126798239-126798261 CAGTGTGTTCTGAGAGAGGAAGG - Intronic
1090871786 11:130755939-130755961 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1090936120 11:131344170-131344192 CAGTGCAAACAGAGAGAAAAGGG + Intergenic
1092247272 12:6870696-6870718 CGGTGTAAGAAGGGAGAGGATGG - Exonic
1092395428 12:8121789-8121811 GAGTGCAAGCAGGGTGAGGAGGG + Intergenic
1092395539 12:8122367-8122389 GAGTGCAAGCAGAGTGAGGAGGG + Intergenic
1092492069 12:8954683-8954705 CAGTGTCAGCAGACAGAGCTAGG + Intronic
1095637823 12:44453083-44453105 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1095778362 12:46033430-46033452 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1096738582 12:53675686-53675708 AAGAGAAAGCAGAGATAGGAGGG + Intronic
1096745016 12:53721149-53721171 CAGTGCAAGATAAGAGAGGATGG - Intronic
1096748646 12:53744893-53744915 CAGGGGAAGCAGAGAGAGAATGG - Intergenic
1097274347 12:57802141-57802163 GAGTGTAAGAAAAGAGAGTAGGG - Exonic
1097625425 12:61994294-61994316 CAGTGTATCAAGAGAGAAGAAGG - Intronic
1097748275 12:63323982-63324004 GAGTGTAACCAGAGAGGGCATGG + Intergenic
1098212126 12:68177542-68177564 GAGGGTAAGAAGAGAGAGGGAGG + Intergenic
1098460794 12:70731024-70731046 GAGAGGAAGGAGAGAGAGGAAGG + Intronic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1098629235 12:72706640-72706662 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1098836088 12:75425707-75425729 GTGTCTAAGCAGAGTGAGGAGGG + Intronic
1098967881 12:76812288-76812310 CAGTTAAAGCAGAGTGATGATGG - Intronic
1099188896 12:79543151-79543173 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1099272322 12:80526128-80526150 CAGAGAAAGCACAGATAGGATGG - Intronic
1099872969 12:88370965-88370987 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1100561535 12:95752450-95752472 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1100621591 12:96281229-96281251 CATTGTAAGGAGACAGAGAAAGG - Intronic
1100691772 12:97046071-97046093 CATTGGGAGCAGAGAAAGGAGGG - Intergenic
1101278221 12:103225099-103225121 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1102983792 12:117262904-117262926 AAGTTTAAGCAAAGAGGGGAAGG - Intronic
1104800585 12:131552899-131552921 CAGTGCAATCAGAGTGAGGCTGG + Intergenic
1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG + Intergenic
1106943621 13:34801924-34801946 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1108513171 13:51173154-51173176 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1108919373 13:55657396-55657418 AAGTGAAAGCAAAGAGAGGATGG + Intergenic
1109353089 13:61208090-61208112 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1109499472 13:63216401-63216423 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1109716564 13:66228806-66228828 AAGTGAAAGCAGAGAGAGGCTGG + Intergenic
1110604411 13:77415068-77415090 AAGTGTCAGGAGAGAAAGGAAGG + Intergenic
1110978659 13:81869467-81869489 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1111125863 13:83910705-83910727 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1111412629 13:87896238-87896260 CAGTGGGAGCAGAGTCAGGATGG - Intergenic
1112237002 13:97645602-97645624 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1112835728 13:103512040-103512062 GAATCTAAGCAGAAAGAGGAGGG + Intergenic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1114416601 14:22549034-22549056 CAGTTGCAGCAGAGAGATGATGG + Intergenic
1114640389 14:24215789-24215811 GAGTGTAATCTGCGAGAGGAAGG + Exonic
1114652205 14:24292384-24292406 CAGTAGAAGCAGAGAGGGCAGGG - Intronic
1115240433 14:31247823-31247845 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1116179852 14:41519234-41519256 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1116490404 14:45497806-45497828 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG + Intronic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1118469355 14:66060894-66060916 CAGAGGAAGCTGAGAAAGGAAGG + Intergenic
1118731607 14:68670692-68670714 CAGTGGAAGATGAGAGTGGATGG - Intronic
1118840017 14:69502862-69502884 CAGAGGGAGCAGAGAGAGGTAGG + Exonic
1119022593 14:71127598-71127620 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1119081085 14:71694343-71694365 CAGTGAAAACAGAGAGTTGAAGG - Intronic
1119317375 14:73706773-73706795 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1119330829 14:73792308-73792330 AAGGGTAAGGAGAGAGAAGAGGG + Intergenic
1120030020 14:79630782-79630804 AATTGTAAGCAGAGAGATGGAGG - Intronic
1120539387 14:85735395-85735417 AAGTGAAAGCGAAGAGAGGATGG + Intergenic
1120618415 14:86734607-86734629 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1121284493 14:92724763-92724785 CAGTACAAGCAGACAGAGTAGGG - Intronic
1123115279 14:105891637-105891659 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123117449 14:105901080-105901102 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123485241 15:20729800-20729822 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1123541729 15:21298849-21298871 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1123882318 15:24688004-24688026 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1124172087 15:27384227-27384249 CATTGCAAGCAGTGAGAAGATGG + Intronic
1125213040 15:37238637-37238659 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1125409901 15:39395254-39395276 CAATGGAAGGAGAAAGAGGAAGG + Intergenic
1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG + Intergenic
1126004122 15:44240434-44240456 CGGTGAAAGGAGAGAGAGAAAGG + Intergenic
1126529978 15:49701562-49701584 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1126785056 15:52171525-52171547 CAGTGAATGCAGAGAAAGGAAGG + Intronic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1127560108 15:60127785-60127807 CACTGTAAGCCGAGACAGGCTGG + Intergenic
1128679372 15:69636855-69636877 CAGTGTAAACAGAGAGCAGCAGG + Intergenic
1129229176 15:74187227-74187249 CAGTGGAGGGAGAGAGAGGTAGG - Intronic
1129265956 15:74393180-74393202 CAGTGCAGCCAGAGAGAGGAGGG - Intergenic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129275394 15:74442114-74442136 CAGTGGATGCAGAGAGGGCAGGG - Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131225603 15:90622396-90622418 GAGTGAAGGCAGAGAGAGCAGGG - Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131583119 15:93664648-93664670 CAGGGTTAGCAGTTAGAGGAGGG - Intergenic
1131684353 15:94754060-94754082 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1131882336 15:96874245-96874267 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1202950044 15_KI270727v1_random:25991-26013 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1132481546 16:168781-168803 AGGTGTGAGCAGGGAGAGGAGGG - Intergenic
1133313592 16:4867737-4867759 CAGAGGATGCAGTGAGAGGAAGG + Intronic
1133938349 16:10286445-10286467 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1134587127 16:15421314-15421336 CAGTGGAATCAAAGACAGGATGG - Intronic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1135361669 16:21820597-21820619 GAGTGTAAGGAGAGACGGGAAGG + Intergenic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1136363225 16:29795102-29795124 CTGTGAAAGCAGGCAGAGGAAGG + Intronic
1137023228 16:35450897-35450919 CAGTGTAGGCAGGGACAGGCAGG + Intergenic
1137627419 16:49918318-49918340 CGGAGTAAGAAGAGTGAGGACGG + Intergenic
1139221163 16:65183676-65183698 CAGAGAAATCAGAGTGAGGATGG - Intergenic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1141462079 16:84183602-84183624 CAGGCTTAGCAGGGAGAGGAAGG + Intronic
1141796715 16:86279825-86279847 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1142921651 17:3192984-3193006 TACTGTAGGCAGAGAAAGGATGG - Intergenic
1143390591 17:6556972-6556994 CAGAGGGAGCGGAGAGAGGAAGG + Intergenic
1144003572 17:11078232-11078254 CAGTGTATGGAGGGAGTGGATGG + Intergenic
1144727830 17:17510801-17510823 CAGCGTAAGGAGAGCCAGGATGG - Intronic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1145209531 17:21003074-21003096 CTGTGGAGGCAGAGAGAGGGAGG + Intronic
1145289462 17:21531776-21531798 CAGTGCATCCAGAAAGAGGAAGG + Exonic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1146605689 17:34255712-34255734 CAGGGTAATCAAAGAGAGGGTGG + Intronic
1146825492 17:36019029-36019051 CAGTGGAGGCACTGAGAGGATGG - Intergenic
1148208127 17:45792270-45792292 CAGAGTTGGCAGAAAGAGGAAGG - Intronic
1148238943 17:45987450-45987472 CAGTTTATGCAGTGAGAAGATGG - Intronic
1148357550 17:46985743-46985765 CAATGGAAGCCCAGAGAGGATGG - Intronic
1148721670 17:49757842-49757864 GAGTGGAAGCAAAGAAAGGATGG - Intronic
1148860536 17:50602214-50602236 GGGTGTGAGCACAGAGAGGAGGG - Intronic
1149023537 17:51998092-51998114 CAGTGCAGACAGACAGAGGAAGG + Intronic
1149232202 17:54547434-54547456 CAGTGCAAGCAGACAGTGAAGGG + Intergenic
1150819258 17:68421905-68421927 CAGAGTGAGCAGGGAGAGGCTGG + Exonic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151622662 17:75255859-75255881 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1151839572 17:76608379-76608401 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1152231419 17:79115749-79115771 CTGTGGAAGGAGAGAGAGCAAGG + Intronic
1152245968 17:79184737-79184759 CACTGTCTGCAGTGAGAGGAGGG - Intronic
1152496907 17:80679813-80679835 AAGAGAAAGCAGAGAAAGGAAGG - Intronic
1153577706 18:6539335-6539357 CAGAGCCAGGAGAGAGAGGAGGG + Intronic
1153752535 18:8247976-8247998 CAGGGATAGCAGAGAGAGGGCGG - Intronic
1155117892 18:22787635-22787657 CAGTGAAAGCAGAGTGAGCGGGG + Intergenic
1155308870 18:24504766-24504788 CTGCGTAAGCTGAGAGAGGGTGG + Intergenic
1155437378 18:25827298-25827320 CAGTGTCTTCAGAGAGAGCAGGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155696845 18:28695536-28695558 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1156504506 18:37580805-37580827 CAGTGTAAGGAGAATGAGAAAGG - Intergenic
1157329954 18:46696452-46696474 CATTGGAGGCAGAGAGAGTAGGG - Intronic
1158433523 18:57415610-57415632 CAGTGTGAGCAGGGACAGAATGG - Intergenic
1158471303 18:57739364-57739386 CAGTGGTAGCAGGAAGAGGAGGG - Intronic
1158707629 18:59807491-59807513 CAATGGAAGCAGCCAGAGGAAGG - Intergenic
1159164650 18:64684916-64684938 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
1159253431 18:65912181-65912203 AAATGCAAGCAGAGAGAGGCTGG + Intergenic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161661907 19:5551762-5551784 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1163357751 19:16825381-16825403 CAGTGGAAGTAGAGAGCGGTGGG - Intergenic
1163567192 19:18058707-18058729 CAGTGTGGGCAGAAAGAGGGAGG + Intergenic
1164153153 19:22571532-22571554 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164562249 19:29300305-29300327 CAGTGTAAGCAGAGGGGTGGAGG - Intergenic
1164798401 19:31055071-31055093 CAGGGCAAGCAGGGAGAGGGAGG + Intergenic
1164866846 19:31611510-31611532 AAGGGAAAGGAGAGAGAGGAGGG + Intergenic
1165163320 19:33831726-33831748 CACTGAGAGCAGAGTGAGGAGGG - Intergenic
1165249420 19:34517282-34517304 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1165269381 19:34691926-34691948 CAGAGAAAGCAGGGAAAGGAGGG + Intergenic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1165835535 19:38752898-38752920 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1166299755 19:41907006-41907028 CAGGGAGAGCAGAGAGAGAAGGG - Intronic
1166357693 19:42236745-42236767 CACTGTGAGAAGAGTGAGGAGGG + Intronic
1166498761 19:43325929-43325951 AAGTGAAAGCAAAGAGAGGCGGG + Intergenic
1166975744 19:46604121-46604143 CAGGGAAAGAACAGAGAGGAGGG - Intronic
1167482968 19:49744524-49744546 CAGTCAGAGCAGAGAGGGGAGGG - Intronic
925363325 2:3294769-3294791 GTGTGTATGTAGAGAGAGGATGG - Intronic
925363491 2:3295588-3295610 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363510 2:3295688-3295710 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363524 2:3295754-3295776 GTGTGTGTGCAGAGAGAGGACGG - Intronic
925363547 2:3295859-3295881 GGGTGTGTGCAGAGAGAGGATGG - Intronic
925363568 2:3295960-3295982 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925363587 2:3296060-3296082 GTGTGTGTGCAGAGAGAGGAGGG - Intronic
925363655 2:3296375-3296397 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925363718 2:3296683-3296705 TTCTGTAGGCAGAGAGAGGACGG - Intronic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926463772 2:13165348-13165370 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
926463913 2:13166415-13166437 AAGTGAAAGCCAAGAGAGGATGG + Intergenic
926630448 2:15130794-15130816 CAGTGTGGGAAGAGAGAGGGTGG - Intergenic
926781487 2:16476426-16476448 GTGTGTAAGCAGAGTGAGAAGGG - Intergenic
926815370 2:16794359-16794381 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
927106049 2:19827026-19827048 GAGTGTTAGCAGAGATAAGAAGG + Intergenic
927134334 2:20085600-20085622 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
928189915 2:29154631-29154653 CAGGGAAATCATAGAGAGGAGGG + Intronic
928271199 2:29856653-29856675 CATCGTAGGCAGACAGAGGATGG - Intronic
928770640 2:34699514-34699536 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
928779538 2:34803387-34803409 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
929076501 2:38083188-38083210 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
929090400 2:38210887-38210909 CAGTGTCAGCAGAGACAACATGG + Intergenic
929399466 2:41563282-41563304 CAGAGTAAAGGGAGAGAGGATGG - Intergenic
929444158 2:41989763-41989785 AGTTCTAAGCAGAGAGAGGAAGG + Intergenic
929588040 2:43128227-43128249 CAGTCTAGGTAGAGAGAAGAAGG + Intergenic
929651512 2:43684356-43684378 CAGTTAAAGGAGAGAAAGGAAGG - Intronic
929823944 2:45295505-45295527 CATCGTAGGCAGAGAAAGGAGGG + Intergenic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
930822019 2:55655835-55655857 CAAGGTTAACAGAGAGAGGAAGG - Intronic
931049168 2:58390691-58390713 CAGGGAAAGCAGAGTTAGGAAGG - Intergenic
931668366 2:64625903-64625925 GAGAGGAAGGAGAGAGAGGATGG + Intergenic
931692558 2:64847725-64847747 TAGTGCAATCAGAGGGAGGAGGG + Intergenic
932018060 2:68053276-68053298 CTGTATAACCAGTGAGAGGAAGG - Intronic
932367069 2:71160360-71160382 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
932437893 2:71713637-71713659 TAGAGTAAGCAGAGAGGAGAAGG + Intergenic
933138113 2:78761195-78761217 AAGTGAAAGCAAAGAGAGGATGG - Intergenic
933340453 2:81018757-81018779 AATAGTAAGCAGAGAGAGAAAGG - Intergenic
933552221 2:83791328-83791350 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
937329114 2:121013540-121013562 CAGTGAAAGCAGTGATAAGAGGG + Intergenic
937669598 2:124524265-124524287 GAGAGTAAGCATAGAGATGATGG - Intronic
938079578 2:128362640-128362662 CAGGGAAAGCAGACAGGGGATGG - Intergenic
938195460 2:129323628-129323650 CACTGTAAGCAAAGAGAAGAGGG + Intergenic
939002717 2:136755001-136755023 CAGGGGAAGCAGTGACAGGATGG - Intergenic
939082976 2:137685363-137685385 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
939839847 2:147173676-147173698 GGGTGTCAGAAGAGAGAGGAAGG - Intergenic
939866145 2:147474924-147474946 CATTGTAATTAGAGAGAAGAGGG - Intergenic
940352806 2:152707638-152707660 CAGTCTGAGCAGAGCCAGGAAGG - Intronic
941353561 2:164462401-164462423 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943079128 2:183236207-183236229 CAGTGTAAACAGAAAGAATAGGG + Intergenic
943286414 2:186007135-186007157 CTGTGAAAACAGAGAGAGGGAGG - Intergenic
944136564 2:196406082-196406104 CAGTGTACACAGAGAAAGGAAGG - Intronic
944394316 2:199250218-199250240 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
944934545 2:204554211-204554233 TACTGTAAGCAGAGAGAGACAGG - Intronic
945020668 2:205567816-205567838 CATTGGAAGCGGAGTGAGGAAGG + Intronic
945173628 2:207020535-207020557 AAGTGGAAGCAAAGAGAGGTTGG - Intergenic
945361810 2:208902515-208902537 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
946214859 2:218176437-218176459 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
946780870 2:223192258-223192280 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
946884363 2:224208348-224208370 CAGTGTGAGCAAGGAGAGGTTGG + Intergenic
946973382 2:225120515-225120537 CAGGGTAGGCAGGCAGAGGAAGG - Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947396743 2:229694468-229694490 CTGTGAAAGCAGACAGAAGAGGG + Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947701161 2:232235155-232235177 CATTTAGAGCAGAGAGAGGAAGG - Intronic
948390867 2:237610238-237610260 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1169967401 20:11232831-11232853 CAGTGGAAACTGACAGAGGATGG + Intergenic
1170480828 20:16763528-16763550 CAGTGAAGGCAGAGAGTGCAGGG - Intronic
1170680264 20:18520024-18520046 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1170942877 20:20863581-20863603 CTGTGGAAGCAGAGAGAGGGCGG + Intergenic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1172612780 20:36264190-36264212 TAGTGCAAGGACAGAGAGGAGGG - Intronic
1173781891 20:45762951-45762973 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1174450746 20:50618591-50618613 CAGGGTAAGCAGGCAGAGGCAGG - Intronic
1174850399 20:53988343-53988365 GAGACTAAGCAGAGAGAGAAAGG - Intronic
1175334246 20:58184830-58184852 CAATGGAAGCAGAGAGAGGCTGG + Intergenic
1175624365 20:60478167-60478189 CTGTGTCAGGAGAGAGAGAAAGG - Intergenic
1175757400 20:61538488-61538510 CAGAGTAGGAGGAGAGAGGAGGG - Intronic
1176886923 21:14267836-14267858 CTGTCTCAGCATAGAGAGGAAGG - Intergenic
1178001366 21:28164492-28164514 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1178413787 21:32387443-32387465 GAGTGGAACCAGAGAGAGGCAGG - Intronic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1179993434 21:44960336-44960358 CAGTGGAGGCACAGAGAGGTTGG + Intronic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1181410024 22:22712234-22712256 CAAAGGAAACAGAGAGAGGAGGG - Intergenic
1181471959 22:23145975-23145997 CAGTGGAAGTAGAGTGGGGAGGG - Intronic
1182045456 22:27270711-27270733 AAGGGTAACCAGAGAAAGGAGGG + Intergenic
1182732457 22:32506060-32506082 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1182767905 22:32772028-32772050 CAGTTTTAGCCCAGAGAGGATGG + Intronic
1184108417 22:42381782-42381804 CAAGGTAAGCAGAGAGGTGAGGG - Exonic
1184345665 22:43911137-43911159 GAATGTAAGCTGAGAAAGGAGGG - Intergenic
1184375827 22:44112027-44112049 GAGTGGAAGCAGGCAGAGGAGGG + Intronic
1184389230 22:44193373-44193395 CAGCGTAGGGAGGGAGAGGATGG + Intronic
1184810570 22:46828734-46828756 CAGTCCAAACAGAGACAGGAGGG - Intronic
949190213 3:1242230-1242252 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
949212235 3:1516802-1516824 AATTGTAACCAGAGTGAGGATGG + Intergenic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949431905 3:3985865-3985887 CCATGTTAGCAGAGAGAGAAAGG - Intronic
949808751 3:7983560-7983582 CAATGAAAACAGAGAGAGGCTGG + Intergenic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950191545 3:10980174-10980196 AACTGGAAGTAGAGAGAGGAGGG + Intergenic
950479505 3:13235776-13235798 CAGTGCCTGCAGAGAGGGGAGGG + Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950926666 3:16747604-16747626 TAGTGAAAGCAAAGAGAGGCTGG - Intergenic
950963827 3:17132196-17132218 CAGTGTCAGCAGGAAGCGGAGGG - Intergenic
951221231 3:20070598-20070620 CAGTATAAGAAAAGAGAGGCCGG - Intronic
951316150 3:21191620-21191642 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
952312624 3:32203874-32203896 CAGTGAAACCAGGGAAAGGAAGG - Intergenic
952558095 3:34557023-34557045 AAATGTAAGCAAACAGAGGAAGG + Intergenic
952663290 3:35876748-35876770 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
952792012 3:37207373-37207395 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
952895877 3:38078698-38078720 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
953076951 3:39580222-39580244 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
953177379 3:40564264-40564286 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
953572363 3:44081275-44081297 CAGTGCAAGCGGAGAGAGACAGG + Intergenic
953825528 3:46248731-46248753 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
954969097 3:54636912-54636934 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
955210533 3:56936277-56936299 AAGTGAAGGCAGAGAGAGAAGGG + Intronic
955424018 3:58768783-58768805 CATTGTAAGAAGAGAGACTACGG - Intronic
956595607 3:70963516-70963538 CAGTGTCTGCAAGGAGAGGAAGG - Intronic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
956709388 3:72026280-72026302 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
957295407 3:78327093-78327115 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
957451611 3:80388168-80388190 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
958479320 3:94626647-94626669 GAGTGCAAGCAGAAAAAGGAGGG - Intergenic
958676627 3:97275402-97275424 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
958921507 3:100111195-100111217 CAATGGAGGCAGAAAGAGGATGG + Intronic
960188810 3:114677844-114677866 AAGAGTAGGCAGAGAGAGGAAGG - Intronic
960876695 3:122303063-122303085 CAGTTCAAGTAGAGAAAGGAAGG - Intergenic
960931822 3:122859327-122859349 CAGTAGAAGAAGAGAGAGCAGGG + Intronic
961293659 3:125866881-125866903 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
961601251 3:128063902-128063924 CAGAGTAACAAGTGAGAGGAAGG - Intronic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
962022083 3:131511973-131511995 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
962205749 3:133432405-133432427 AGGTGAAAGCAGAGAGAGGCTGG - Intronic
962270274 3:133973065-133973087 AAGTGGAAGATGAGAGAGGATGG + Intronic
962318970 3:134375521-134375543 CAGGGTAAGTGGAGAGAGGAGGG - Intergenic
962961607 3:140316192-140316214 CAGTGCAAGCAGTGAGGTGAAGG + Intronic
963266941 3:143249342-143249364 CAGTGTAAGAAAATATAGGATGG - Intergenic
963425392 3:145116272-145116294 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
963456493 3:145553607-145553629 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
963520614 3:146356840-146356862 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
963521791 3:146365345-146365367 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
963663521 3:148154939-148154961 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
963684502 3:148417636-148417658 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
964175851 3:153825690-153825712 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
966085597 3:176064626-176064648 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
966232679 3:177668273-177668295 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
967005177 3:185376957-185376979 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
967135657 3:186510643-186510665 CAGTGGAAGCAGCCACAGGATGG - Intergenic
967244008 3:187468694-187468716 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
967496397 3:190147789-190147811 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
968983278 4:3862496-3862518 CAGTGGGGGCAGAAAGAGGAGGG - Intergenic
969179614 4:5427922-5427944 CAAAGTAAGCAGAGAGAAGGAGG - Intronic
970042250 4:11809566-11809588 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
970087715 4:12367054-12367076 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
970256240 4:14172945-14172967 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
973342119 4:49016396-49016418 TGGTGTAAGAAGGGAGAGGATGG + Intronic
973580879 4:52342972-52342994 CAGTGTAAGTTGTGAAAGGAAGG - Intergenic
975616577 4:76252797-76252819 CACTGTAAGCAGCTAGGGGAAGG - Intronic
976317471 4:83673826-83673848 CTGTGAAAGCAGGGAGAGGAGGG - Intergenic
976558736 4:86477873-86477895 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
977062331 4:92273924-92273946 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
977218999 4:94316673-94316695 CATTCTAAGCAGAGAGAAAATGG - Intronic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977760918 4:100735954-100735976 CAGTGTAAGCACAAAGACCATGG - Intronic
977796254 4:101168497-101168519 CAGTGAATGTAGATAGAGGAGGG + Intronic
979273570 4:118791535-118791557 CCGTGGAGGGAGAGAGAGGAGGG - Intronic
979380114 4:119997210-119997232 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
979562563 4:122116908-122116930 CAATGGAAGCAGAGTGAGGAAGG + Intergenic
980528036 4:134015454-134015476 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
980575454 4:134680335-134680357 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
980904113 4:138931152-138931174 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
982496942 4:156105904-156105926 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
983024050 4:162712386-162712408 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
983452505 4:167926178-167926200 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
983659745 4:170119738-170119760 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
984165183 4:176297273-176297295 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
984278644 4:177640208-177640230 CAGGGTAAGCAGAGCCAGAAAGG - Intergenic
984322359 4:178210376-178210398 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
984437439 4:179723734-179723756 AAGTGAAAGCTAAGAGAGGATGG - Intergenic
986193700 5:5518831-5518853 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986389050 5:7266873-7266895 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
986532040 5:8747750-8747772 CAGAGAAAGAAGAGAAAGGATGG - Intergenic
986905937 5:12493033-12493055 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987755996 5:22098125-22098147 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
987930556 5:24395004-24395026 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
988199271 5:28048930-28048952 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
989019657 5:36988047-36988069 TAGGGTAAGCTGAGAGGGGAGGG - Intronic
989303750 5:39927132-39927154 GAGTCTAAGCAGGGTGAGGAGGG + Intergenic
989715172 5:44454410-44454432 CAGTTTTAACAGAGAGAGGGAGG + Intergenic
990049582 5:51481030-51481052 CAGTGTAAGCTGAGAGCAGGTGG - Intergenic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
990934842 5:61136996-61137018 CAGAGTAAGCTGAGAGAATATGG + Intronic
990981452 5:61605863-61605885 CAGTGTAAGAATTAAGAGGATGG + Intergenic
991111003 5:62899297-62899319 TAGTATAAGCAGAGAGAGAGAGG + Intergenic
991131696 5:63130199-63130221 CTGGGTAAGCAGATATAGGATGG - Intergenic
991445824 5:66698924-66698946 AAGTGGAAGCAGAGAGACCAAGG - Intronic
992299376 5:75362948-75362970 CACTGGAAGCCGAGAGAAGATGG + Intergenic
992673879 5:79085912-79085934 CAAAGTAAGAAGAAAGAGGATGG + Intronic
992992356 5:82297261-82297283 TAGCGGAAGCAGAGAGAGAAGGG + Intronic
993285793 5:85994080-85994102 CAGTGCAAGCAGAGAAACAAAGG - Intergenic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994075103 5:95641747-95641769 GAGTGTTAGCAGAGATAGGGAGG - Intergenic
995122682 5:108552561-108552583 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
996052456 5:118949318-118949340 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
996341726 5:122445861-122445883 GAGTGGAAGGAGAGAGAGAAGGG - Intronic
996358446 5:122621291-122621313 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
996574814 5:124969034-124969056 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
997398374 5:133582385-133582407 CAGTGAGAGCTGAGAGAGGAGGG + Intronic
997425835 5:133801971-133801993 CACAGTAGGCTGAGAGAGGAAGG - Intergenic
997724699 5:136110719-136110741 GAGTGTAAGCAGAGAGCTGATGG + Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997746572 5:136304598-136304620 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
997770458 5:136548752-136548774 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
998494462 5:142575498-142575520 CAGAGGAAGAGGAGAGAGGAGGG - Intergenic
999618698 5:153452131-153452153 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
999642904 5:153689758-153689780 CAATGTGAGTAGGGAGAGGATGG - Intronic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000041250 5:157486682-157486704 GAGTGCCAGCAGAGGGAGGAGGG - Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000885151 5:166741519-166741541 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1001134267 5:169089552-169089574 GAGTGTAGGCAGAGAGTGCACGG - Intronic
1002610775 5:180417150-180417172 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1002961644 6:1920744-1920766 CAGTGAAAGAAGAGACAGGTGGG + Intronic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003335499 6:5168129-5168151 CAGTGGGAGAAGAGAGAGGAAGG + Intronic
1003863023 6:10339097-10339119 CAGTGTCATCAAAGAGAGGGAGG - Intergenic
1004106433 6:12670646-12670668 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1004283347 6:14299380-14299402 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1006325793 6:33352865-33352887 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
1006376957 6:33676994-33677016 CGCTGAAAGCAGAGAGAGGAAGG - Exonic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007730751 6:43944122-43944144 CATGGAGAGCAGAGAGAGGAAGG - Intergenic
1007731713 6:43951491-43951513 CAGTGCAGCCAGAGACAGGAGGG + Intergenic
1009269990 6:61603388-61603410 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1009379312 6:63008610-63008632 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1011367727 6:86600797-86600819 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1011423829 6:87203925-87203947 AAGCCTAAGCAGAGTGAGGAGGG + Intronic
1011507445 6:88061949-88061971 CAATGTTAGCTGAGAGAGGGTGG - Intronic
1012675265 6:102105239-102105261 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1012987756 6:105893135-105893157 CAGTCAAAGCAGACAGAGGGAGG + Intergenic
1013071154 6:106730543-106730565 CAGTGGAACCAGCGAGATGATGG + Intergenic
1013290941 6:108718164-108718186 CAGTGTGAGAAGCCAGAGGAAGG + Intergenic
1014793817 6:125704287-125704309 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015271544 6:131342155-131342177 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1016113974 6:140259871-140259893 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1016278064 6:142378648-142378670 GAAAGGAAGCAGAGAGAGGAAGG - Intronic
1016404593 6:143716830-143716852 CTGGGTGAGCAGGGAGAGGAGGG + Intronic
1016535586 6:145105576-145105598 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1017083677 6:150693543-150693565 CAGTGTGACCAAAGAGAGGGTGG - Intronic
1017389679 6:153924773-153924795 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1017620548 6:156292177-156292199 CCTTGTGAGCAGACAGAGGAAGG + Intergenic
1017766653 6:157612398-157612420 CGGTGCAAGCCGAGAGAGGTGGG - Intronic
1017779173 6:157703078-157703100 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1018250244 6:161862364-161862386 AAGTGGGAGCAGAGAGAGTAAGG + Intronic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019805046 7:3117547-3117569 AAGAGAAAGGAGAGAGAGGAGGG + Intergenic
1020224538 7:6269752-6269774 CAAGATAAGGAGAGAGAGGATGG - Intronic
1020316220 7:6907066-6907088 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1020540969 7:9460984-9461006 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1020636735 7:10705001-10705023 CAGAGTATGTAGGGAGAGGAAGG - Intergenic
1021172849 7:17417136-17417158 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
1021481347 7:21121096-21121118 GAGGGCAAGAAGAGAGAGGAAGG - Intergenic
1021977732 7:26026619-26026641 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1022373047 7:29788126-29788148 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022572623 7:31469457-31469479 AAGTGAAAGCGGAGAGAGGCTGG + Intergenic
1022838226 7:34136978-34137000 CAGAGAAAGCAGAGAGCAGAGGG + Intronic
1023088637 7:36597394-36597416 CATTGTAAGCAGAAAGATGTAGG - Intronic
1023659977 7:42461266-42461288 CACTGTAAGGAGGGAGATGATGG - Intergenic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878806 7:44307179-44307201 GGGTGTGAGCAGAGAGAGGAGGG + Intronic
1023915468 7:44585448-44585470 CAAAGTAACCAGAGAGATGAGGG - Intergenic
1024268703 7:47626083-47626105 CAGTGAGAGCAGAGAGAGAAAGG + Intergenic
1025250157 7:57346537-57346559 CAGTGAATGGAGAGAGAGGTAGG + Intergenic
1026013648 7:66655291-66655313 CAGTTTAGGGAGAGAGAGGGAGG + Intronic
1026025652 7:66741452-66741474 CAGTTTAGGGAGAGAGAGGGAGG + Intronic
1027297058 7:76787275-76787297 CACTGTAAGAAAAGAGATGATGG - Intergenic
1027355443 7:77349775-77349797 AAGTGAAAGAAGAGAGAGGAAGG - Intronic
1028670676 7:93397219-93397241 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
1028690343 7:93643144-93643166 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1029401161 7:100347373-100347395 CAGTGGAAGCAGTGCTAGGACGG + Intronic
1029449240 7:100631757-100631779 AGGAGGAAGCAGAGAGAGGAAGG - Intronic
1029571651 7:101373716-101373738 AAGTGTGAGCACATAGAGGAGGG + Intronic
1030170610 7:106599156-106599178 CAGGGTAGGCAGGGAGAGGAAGG - Intergenic
1030199597 7:106889181-106889203 GAGAGTAAGCAGAGAGGGGTTGG - Intronic
1030844591 7:114393467-114393489 GAGTCTGACCAGAGAGAGGAGGG + Intronic
1031004846 7:116458791-116458813 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1031068392 7:117134020-117134042 CAGGGTAATCAAAGAGGGGAAGG - Intronic
1031196053 7:118615328-118615350 CAGTGGAAGTAAAGAGAAGAGGG + Intergenic
1031274642 7:119704644-119704666 CATTGTAAGTAGTGAGAGGCAGG - Intergenic
1031503218 7:122547762-122547784 AATTGGAAGCAGAGAGAGAAGGG + Intronic
1031686016 7:124732318-124732340 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1031744936 7:125483636-125483658 GTGTGTAAGAAGACAGAGGAGGG + Intergenic
1031999729 7:128256993-128257015 CAGAGAAAGAAGAGACAGGAGGG + Exonic
1032108799 7:129057082-129057104 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
1032498809 7:132384092-132384114 CAGTGCAAGCACACAGATGAAGG + Intronic
1033464869 7:141581250-141581272 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1033631900 7:143166495-143166517 CAGTGTGACCAAAGAAAGGAAGG - Intergenic
1034084647 7:148312474-148312496 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1034784358 7:153911570-153911592 CATTGCAAACTGAGAGAGGAAGG - Intronic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035215617 7:157364285-157364307 CAGTGTCACCAGAGAAAGCAAGG - Intronic
1035339473 7:158151217-158151239 CAGTGTGGGCAGGGAGAGGCAGG - Intronic
1036339819 8:7905852-7905874 AAGTGGAAGCAAAGAGAGGCTGG + Intergenic
1036526545 8:9540262-9540284 GAGTGAAAGCACAGAGATGAGGG + Intergenic
1036751857 8:11448711-11448733 CAATGTGAGCAGAGAGGGAAGGG - Intronic
1037415538 8:18645931-18645953 GAGTGTGTGCAGAGAGAGGTAGG - Intronic
1038379552 8:27079860-27079882 TACTTGAAGCAGAGAGAGGATGG - Intergenic
1038687840 8:29734523-29734545 CAGTATAAGAACAGAGAGAATGG - Intergenic
1039099002 8:33920849-33920871 AAGTGGAAACAGAGAGAGGGAGG + Intergenic
1040456600 8:47604493-47604515 TAGTGAAAGCAGAGAGACGCAGG + Intronic
1040993413 8:53376263-53376285 CAGTCTAAGGAGAGTCAGGAGGG + Intergenic
1041296488 8:56362479-56362501 CAGTTCAAGGAGAGAGGGGATGG - Intergenic
1041648229 8:60275365-60275387 CAGAGTAAACAGAGACAGGTAGG + Intronic
1042903953 8:73754541-73754563 CACTGGATGCACAGAGAGGATGG - Intronic
1043045257 8:75314999-75315021 GAGTGAAAGCAAAAAGAGGATGG + Intergenic
1043400481 8:79879583-79879605 CAGGGTGAGCATAGAGAGGTGGG + Intergenic
1043406744 8:79943720-79943742 GAATGTATGCAGAGAGGGGAGGG - Intronic
1043717729 8:83507575-83507597 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1043778193 8:84297189-84297211 CAGTGGGAGGAGGGAGAGGAAGG - Intronic
1044417265 8:91951247-91951269 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1044922167 8:97178363-97178385 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1045357464 8:101402443-101402465 CAGTGTAGGCAGCTAGTGGAGGG + Intergenic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1046440186 8:114244625-114244647 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1047195184 8:122714557-122714579 AAGTGGAAGCACAGATAGGAAGG + Intergenic
1047699526 8:127435004-127435026 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1048097770 8:131313481-131313503 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1048168257 8:132082658-132082680 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1048275304 8:133061565-133061587 TGGTGGAAGCACAGAGAGGAAGG + Intronic
1048349237 8:133602611-133602633 CAGTGATAGCAGAAAGAAGAGGG + Intergenic
1048384650 8:133900901-133900923 GAGCCTAAGCAGAGTGAGGAGGG - Intergenic
1048585255 8:135769575-135769597 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1048903238 8:139060531-139060553 CTGTGGAAGCAGAGATTGGAGGG - Intergenic
1049009029 8:139875154-139875176 CGGGGGAAGAAGAGAGAGGAGGG + Intronic
1049236748 8:141515933-141515955 CAGTGTGAGGAGAGAGACGATGG - Intronic
1049855745 8:144860726-144860748 CAGTGCTGGCAGAGAGGGGAGGG + Intergenic
1049975786 9:860448-860470 CAGAGTAAGAAGAGTGAGGGAGG - Intronic
1050185209 9:2965772-2965794 CAGGGTAAGGAGAGAGTGGCAGG + Intergenic
1050934491 9:11377978-11378000 TAGTGTAAGCAGAGACACAATGG + Intergenic
1051052801 9:12951631-12951653 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1051545381 9:18268537-18268559 CATTGTCAGCCCAGAGAGGATGG - Intergenic
1051978557 9:22984736-22984758 CAGAGTAAGCACAGATAGAATGG + Intergenic
1052720469 9:32166952-32166974 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1054807314 9:69407173-69407195 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1055233242 9:74088947-74088969 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1056273473 9:84969941-84969963 CATTGGAAGCAGGGAGATGAGGG + Intronic
1056363876 9:85883984-85884006 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1057870897 9:98716430-98716452 CAGTGTTAGCAGAGTCAGCATGG - Intergenic
1058164901 9:101608165-101608187 CAGTGTGTGTAGAGATAGGAGGG - Intronic
1058567137 9:106298054-106298076 CAGTGTAGTCAGAGAAAAGAGGG + Intergenic
1058804526 9:108578032-108578054 GCGTGTGAGCAGAGAGAGAAGGG - Intergenic
1058839868 9:108895662-108895684 TATTTTAAGCAGAGAGATGAAGG + Intronic
1059500851 9:114752766-114752788 CAGTGAAAGGAGTTAGAGGAAGG - Intergenic
1059546005 9:115177046-115177068 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1060495297 9:124113744-124113766 CAGGGCAGGCAGAGAGGGGAGGG + Intergenic
1060737705 9:126077050-126077072 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1060881972 9:127123693-127123715 CAGAGTAAGAAAGGAGAGGATGG + Intronic
1061583241 9:131550357-131550379 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1062095176 9:134699433-134699455 GGGAGGAAGCAGAGAGAGGAAGG - Intronic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1062728672 9:138096211-138096233 CAATGTGATCACAGAGAGGAAGG + Intronic
1186144155 X:6608518-6608540 CAGTGTAAGCGGAGTCAGGCAGG - Intergenic
1186202518 X:7168737-7168759 CTGGGTAAGGACAGAGAGGAAGG - Intergenic
1186544442 X:10434288-10434310 GGGTGTAGGCAGAGAAAGGAGGG - Intergenic
1187541098 X:20196168-20196190 CAGTGTAAGCAAAGATGTGAAGG + Intronic
1187849760 X:23580231-23580253 CAGTGTCAGCAAAGAGGTGAGGG - Intergenic
1188463207 X:30451524-30451546 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1189153422 X:38730453-38730475 CAGTTTACACAGAGAGAGGCAGG - Intergenic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1189164910 X:38851200-38851222 AAATGAAAGCAGAGAGAGAATGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1190039934 X:47062822-47062844 GAGTGCAAGTAGTGAGAGGAGGG - Intergenic
1190477239 X:50840198-50840220 CTGTGCCTGCAGAGAGAGGAAGG - Intergenic
1191119660 X:56890468-56890490 GAGTGTAAGCAGAAGCAGGATGG + Intergenic
1191800817 X:65077359-65077381 CAGTGGAAGCAGAGAAGGGCTGG - Intergenic
1192175346 X:68881492-68881514 AAGGGTAAGCAGGGAGAGGTGGG - Intergenic
1194147629 X:90282326-90282348 AAGAGTCAGCAGACAGAGGAAGG + Intergenic
1194367275 X:93026216-93026238 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1194465996 X:94236359-94236381 AAGGGAAAGGAGAGAGAGGAAGG - Intergenic
1194660856 X:96627315-96627337 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1196093923 X:111777868-111777890 CTGTGGAAACACAGAGAGGAGGG - Intronic
1196220815 X:113111142-113111164 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1196525302 X:116723381-116723403 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1197005766 X:121495469-121495491 CAATGAAAGAAGAGAGAAGATGG - Intergenic
1197326915 X:125105691-125105713 CAGTGACAGCACAGAAAGGATGG + Intergenic
1197499889 X:127229877-127229899 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1198480746 X:137037641-137037663 AAGTGAGATCAGAGAGAGGAAGG - Intergenic
1198598616 X:138262090-138262112 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1198599227 X:138266742-138266764 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1198827117 X:140711128-140711150 CACTGGAAGCACAGAGAGGAAGG - Intergenic
1198871370 X:141179786-141179808 CAGTGTAAGGATTGAGGGGAGGG + Intergenic
1199152720 X:144505996-144506018 CAGTGTAAGGACAGAGAGATTGG - Intergenic
1199576650 X:149318946-149318968 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1200675485 Y:6142475-6142497 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1201724176 Y:17135510-17135532 GAGAGTAAAAAGAGAGAGGAAGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic