ID: 915725686

View in Genome Browser
Species Human (GRCh38)
Location 1:158015414-158015436
Sequence CTTGGTTCCCAACTCTCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915725686_915725694 30 Left 915725686 1:158015414-158015436 CCATTGGAGAGTTGGGAACCAAG 0: 1
1: 0
2: 1
3: 10
4: 134
Right 915725694 1:158015467-158015489 CTTTTACTGAACTGAGCATTTGG 0: 1
1: 0
2: 0
3: 13
4: 162
915725686_915725689 -8 Left 915725686 1:158015414-158015436 CCATTGGAGAGTTGGGAACCAAG 0: 1
1: 0
2: 1
3: 10
4: 134
Right 915725689 1:158015429-158015451 GAACCAAGATGGAATGGTTTTGG 0: 1
1: 0
2: 2
3: 45
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915725686 Original CRISPR CTTGGTTCCCAACTCTCCAA TGG (reversed) Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
902884160 1:19393061-19393083 CCTGCTCCCCAACTCCCCAAGGG + Intronic
905952160 1:41960945-41960967 CATGGATCCCAACTCTCCATGGG - Intronic
907034192 1:51201714-51201736 CTTGGTTCAAAACCTTCCAATGG + Intergenic
910543378 1:88386747-88386769 CTTGGCTCAAAACACTCCAATGG - Intergenic
910686028 1:89917540-89917562 CTTTGTTCCCCTCTCTCCACAGG + Intronic
911086651 1:93984048-93984070 CTTGGGTACCAACTCTCTAATGG + Intergenic
911566303 1:99466582-99466604 CTTGGCTCAAAACTCACCAATGG - Intergenic
915725686 1:158015414-158015436 CTTGGTTCCCAACTCTCCAATGG - Intronic
916338483 1:163700387-163700409 CTTATTTCCCAACTCTCTCAAGG + Intergenic
916829594 1:168476968-168476990 CTTGGCTCAAAACTCTCCAGTGG - Intergenic
916849706 1:168690981-168691003 CTTGGTCCCCCAGTCTCCCAAGG + Intergenic
922041548 1:221903074-221903096 CTTGGATCCCATGCCTCCAAGGG + Intergenic
923246276 1:232135975-232135997 CTTGGTTACTAACTTTTCAATGG - Intergenic
924206340 1:241714968-241714990 CTGGGTTCCAAATTTTCCAAAGG - Intronic
924408836 1:243782142-243782164 CTTGGTTCTCTTGTCTCCAAAGG - Intronic
1064370664 10:14749623-14749645 CTCGGTTCCCATCTCTGCGAAGG - Intronic
1064993043 10:21273305-21273327 CTTGGAGACCAGCTCTCCAAGGG - Intergenic
1065277068 10:24096176-24096198 CTGGGTTCCCAACTCCTTAAAGG + Intronic
1065341911 10:24715560-24715582 CTTGGTTACCAGCTTCCCAAAGG + Intronic
1067691353 10:48504237-48504259 CTTAGCTCCCCACTCTCCAGAGG + Intronic
1068060469 10:52063156-52063178 CCTGGTTCCCACATCTTCAAGGG + Intronic
1070383948 10:75906951-75906973 CTTGGTTTTCAACTCTCCCCTGG - Intronic
1071030475 10:81174322-81174344 CTTGATTACCATCTTTCCAAAGG - Intergenic
1073285465 10:102384966-102384988 CTTGGTTTCCACCTCCGCAATGG + Intergenic
1076803685 10:132844691-132844713 CTTGGTCCCCAAAGCTCCTATGG + Intronic
1078523985 11:12086673-12086695 CCTGCTTCCCATCTCTCCAAGGG + Intergenic
1079100595 11:17539220-17539242 CTTTGTCCCCAACTCTGCCATGG + Intronic
1083179198 11:60973284-60973306 CTGGGTTCCCACCTCTCCTGTGG - Intronic
1088119577 11:106352237-106352259 CTTGGTCCCCAAATCTCTAAAGG - Intergenic
1088866309 11:113851271-113851293 CTTTGCTCCAAACTCTTCAAAGG + Intronic
1094125461 12:27018384-27018406 TTTGCTTCTCAGCTCTCCAATGG - Intergenic
1095346250 12:41152381-41152403 CTTTGTTCCCATTTCTCAAATGG + Intergenic
1096843904 12:54395016-54395038 CCTGGTCCCCAACACTCCCAAGG - Intergenic
1097107433 12:56634079-56634101 CTTGTTTCCAAACTTCCCAATGG + Intronic
1097766480 12:63532660-63532682 CTTGGTTCTCACCTCTCTCAAGG + Intergenic
1099914384 12:88874023-88874045 CTTGTTTCACAACCCACCAAGGG + Intergenic
1101806543 12:108069159-108069181 CCTGGATGCCAAATCTCCAAAGG - Intergenic
1105423250 13:20271880-20271902 CTTCCTTCCCAACTCACCCACGG + Intergenic
1106795385 13:33199962-33199984 ATTGGTTCTCTACTCCCCAAAGG - Intronic
1107890570 13:44910667-44910689 CTTTTCTCCCAACTTTCCAAGGG - Intergenic
1113131058 13:107037338-107037360 TCTGGTTCCCAACTCCCCAATGG + Intergenic
1117250884 14:53936099-53936121 GTTGGAGCCCCACTCTCCAATGG - Intergenic
1121311298 14:92936534-92936556 CTTGGTTCCCAAATCCCAACTGG - Intergenic
1125163050 15:36669667-36669689 CTTGTTTCCCAAGTCTCCTCTGG + Intronic
1127525777 15:59791177-59791199 CCTGGATCCCAAGCCTCCAAGGG + Intergenic
1136254549 16:29029412-29029434 CTTGGTTCCCACCCCTCCCCCGG - Intergenic
1139300990 16:65945341-65945363 CTTTGGTCCCAACTCTGCTATGG - Intergenic
1141209008 16:81958816-81958838 CTTGGTCCACAGCTCTCCACAGG + Exonic
1141224413 16:82101484-82101506 CTCTGTTCCCTACTCTCCTAAGG - Intergenic
1141865645 16:86748082-86748104 CGCGGTCCCCAGCTCTCCAATGG - Intergenic
1142685719 17:1575917-1575939 CCCGGTTCCCAACTCTTCACAGG + Intronic
1143448895 17:7024039-7024061 CTTGGTTCCCCAGCCCCCAAAGG + Intronic
1145924656 17:28637195-28637217 CTTGGTTCCCGGCTCTCAAAGGG + Intronic
1148804226 17:50256223-50256245 CTTGGGTCCCAGCTCAGCAAGGG - Intergenic
1149329993 17:55570636-55570658 CCTGGATCCCATGTCTCCAAGGG - Intergenic
1155489802 18:26389326-26389348 CATGGTTCCAAAATCTTCAATGG - Intronic
1159225148 18:65523697-65523719 CTTGGCTCCCCACTGGCCAAGGG - Intergenic
1161453143 19:4357674-4357696 CTGGGGCCCCAACTCTCCAGTGG - Intronic
1163785435 19:19272775-19272797 CTAGGTTCCAAAGTCACCAAGGG - Intronic
1165632021 19:37309472-37309494 ATTGGTTTCCTAGTCTCCAAAGG - Intergenic
925796821 2:7554597-7554619 CTTCTTTCCCAAATCTCTAATGG - Intergenic
925976035 2:9142808-9142830 CTTGTTACCCCACCCTCCAAAGG - Intergenic
928393991 2:30930298-30930320 CTCAGGTCCCAGCTCTCCAAGGG + Intronic
928867601 2:35935697-35935719 GTTGGTTGCAAACTCACCAATGG + Intergenic
931988262 2:67762017-67762039 CTTGGCTCCCTTGTCTCCAAAGG - Intergenic
932445237 2:71776838-71776860 TTTGATTCCCAACTCTACCATGG - Intergenic
934552771 2:95272316-95272338 CTTATTTCCCAAGTCTCCAAGGG + Intergenic
934696387 2:96403686-96403708 CTTGGATCCCATGCCTCCAAGGG + Intergenic
936983754 2:118288724-118288746 CTTGGTTCCTAACTCTTGAAGGG - Intergenic
937232432 2:120405939-120405961 CTTGGCTGGCAACTCTCCACAGG - Intergenic
944649912 2:201819499-201819521 CCTGGTTCCAAACCCTCCAGTGG - Intronic
945703998 2:213206332-213206354 ATTGGGTCCAAACTCTGCAATGG - Intergenic
948957068 2:241301695-241301717 CATGGTTCTCAACTGTCGAATGG + Intronic
1169362794 20:4965348-4965370 CTTGGATCTCAACTCTTCCAAGG + Intronic
1169762151 20:9107723-9107745 CTTGGGTCCCAATTCTCCAAAGG - Intronic
1169844947 20:9979845-9979867 CTTTGTTTGCAACTCTTCAAGGG - Intergenic
1171187419 20:23132868-23132890 CTTGGCCCCCAGCCCTCCAAAGG - Intergenic
1172633393 20:36393633-36393655 TTTGGTTCTCAGCTCTCTAAAGG - Intronic
1174120716 20:48263276-48263298 CATAGCTCCCAACCCTCCAAAGG + Intergenic
1174932904 20:54834881-54834903 CATGGTTTCCAACCATCCAATGG + Intergenic
1175577176 20:60069081-60069103 CTTCCCTCCCAACCCTCCAACGG + Intronic
1175732843 20:61365756-61365778 CTTGGTTACTGTCTCTCCAAAGG - Intronic
1176273042 20:64246459-64246481 GATGGTTCCCAACTCTCCTGAGG - Intergenic
1183505967 22:38209016-38209038 CATGGTTCCCTACTATCCTAAGG - Intronic
949161194 3:884399-884421 CTTGTTCCCCAACCCTCCAGCGG + Intergenic
953349475 3:42203984-42204006 CTGGGTTCCACAGTCTCCAAAGG + Intronic
953880092 3:46686971-46686993 CCTGGTACCCACCTCCCCAATGG + Exonic
957459275 3:80496617-80496639 CTTGGATCCCATGTCTGCAAAGG + Intergenic
963379838 3:144514500-144514522 CTTGGCTCACAACCCTCCAATGG + Intergenic
966766403 3:183466725-183466747 ATTTGTTTCCAGCTCTCCAAGGG + Intergenic
966840287 3:184082319-184082341 CCTGGATCCCACCCCTCCAAGGG - Intergenic
967593435 3:191303909-191303931 CTTGGTCCCAGACTCTTCAATGG + Intronic
967980013 3:195060072-195060094 CTAGGGTCCCAACTCTACACAGG - Intergenic
967982095 3:195071865-195071887 CTTCGTTCCCACCCCTCGAAGGG - Intronic
969708693 4:8830527-8830549 CTTTGGTCCCAAATGTCCAAAGG + Intergenic
973221489 4:47731958-47731980 CTTTGTCCCCACATCTCCAAGGG - Intronic
976062642 4:81147398-81147420 TTTGGATGCCAACTCTCAAATGG - Intronic
976250873 4:83050845-83050867 GTTTGTTCACAATTCTCCAATGG - Intronic
981876374 4:149551029-149551051 CTCTGTTCCCAATCCTCCAATGG + Intergenic
982919911 4:161260146-161260168 TTTTGTTCAGAACTCTCCAAAGG + Intergenic
983940875 4:173532998-173533020 CTTGCTTCACAACTTCCCAAAGG - Intergenic
983976783 4:173944594-173944616 CTTGGAACCCAAGTCTCTAAAGG + Intergenic
984823261 4:183903122-183903144 CTTTGATCCAAACTCTTCAACGG + Intronic
987088637 5:14491367-14491389 ATGGGTTCCCAAGGCTCCAAAGG - Intronic
987753613 5:22071806-22071828 CTTGAGTCCCAAATCTACAAGGG + Intronic
995024663 5:107405716-107405738 CTGTGTTCTAAACTCTCCAATGG + Intronic
998323585 5:141257367-141257389 CTTAATTTCCAACTATCCAAAGG + Intergenic
999121371 5:149212123-149212145 CTTGGCTTAAAACTCTCCAATGG - Intronic
1001010847 5:168096734-168096756 CAAAGTCCCCAACTCTCCAAGGG + Intronic
1001125938 5:169019239-169019261 CTTGCTTCCCGCCTCTGCAAAGG - Intronic
1003529089 6:6922771-6922793 CTTGCTTCTCTACTCTCCACTGG + Intergenic
1005224432 6:23624934-23624956 CTTGGTTTCCTAATTTCCAAAGG + Intergenic
1007657976 6:43464080-43464102 CTTTGTTCCAAACCCTCCAGTGG + Intergenic
1008635926 6:53410968-53410990 CTTGGTTCTCAGCTTTACAATGG - Intergenic
1009515417 6:64610063-64610085 TTCTGTGCCCAACTCTCCAATGG + Intronic
1012141879 6:95635570-95635592 CTTGGATCCCACACCTCCAAGGG + Intergenic
1012946583 6:105472781-105472803 CTTGATTACAAACTCCCCAAAGG + Intergenic
1016200136 6:141395887-141395909 CCTGGATCCCAAGCCTCCAAGGG - Intergenic
1016302294 6:142645968-142645990 TCTGGTTCCCCACTCACCAAAGG + Intergenic
1017818068 6:158029141-158029163 CCTGGGTCCTAACTCTCCAGAGG - Intronic
1020099644 7:5387967-5387989 CATGGTGCCCAAACCTCCAAAGG + Exonic
1022129145 7:27387880-27387902 CTTGGTTCCCAACTTACAATGGG - Intergenic
1022501649 7:30885727-30885749 CTTGATACCCAACTCTCACAAGG - Intronic
1023743398 7:43301104-43301126 CGTGGCCCCCCACTCTCCAATGG + Intronic
1031155868 7:118111434-118111456 CTCTGTTCCCAGCTCTCCAGAGG + Intergenic
1032700303 7:134373293-134373315 ATTGGATCCCAAGTCCCCAAGGG + Intergenic
1033232363 7:139610499-139610521 CTTCGTTCCTCTCTCTCCAATGG - Intronic
1036441397 8:8784219-8784241 CTTACTTCCCAACTATTCAATGG + Exonic
1041635610 8:60139170-60139192 CTCCCTGCCCAACTCTCCAAGGG + Intergenic
1045411632 8:101926248-101926270 CTTGGTTCTCAACTTTCCCGAGG + Intronic
1046414199 8:113890069-113890091 CTTGGTTTCCTCCTCTCCACTGG + Intergenic
1049507880 8:143013526-143013548 CTTGGTTCCCGCCTCTCCCAGGG - Intergenic
1050785077 9:9390302-9390324 CTTTGCTCAAAACTCTCCAATGG - Intronic
1051484978 9:17598510-17598532 CTTGGCCCGCAACTCTGCAAAGG - Intronic
1052106914 9:24530017-24530039 ATTTGTTCCAAACTGTCCAAAGG - Intergenic
1055386875 9:75771996-75772018 CTTGGGTCCCTACACTACAAGGG - Intergenic
1056845377 9:90032915-90032937 CTGGGTTCCCATCTATCAAAAGG - Intergenic
1060412471 9:123408918-123408940 CTTGGATCCCAAGCCTCGAAGGG + Intronic
1060907100 9:127316404-127316426 CTTCTTACCCAACACTCCAAAGG - Intronic
1061260983 9:129481049-129481071 CTTTGTTTCCACCTCTGCAAAGG + Intergenic
1186374768 X:8987785-8987807 CTTGTTTTGCAACTCTCCATGGG + Intergenic
1186538930 X:10379949-10379971 TTTGGTTCCCAAGTCTTGAAAGG + Intergenic
1189199294 X:39178009-39178031 CTTGGTTCAAAACCCTCCCAGGG + Intergenic
1191682800 X:63858454-63858476 CTTCGTTCCCACCTTGCCAATGG + Intergenic
1192802360 X:74478804-74478826 ATTGGTCCCCAACTCTCCTCTGG + Intronic